m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00892)
Target Name Serine/threonine-protein kinase PAK 6 (PAK5)
Synonyms
EC 2.7.11.1; PAK-5; p21-activated kinase 6; PAK-6
    Click to Show/Hide
Gene Name PAK5
Chromosomal Location 15q15.1
Family Protein kinase superfamily, STE Ser/Thr protein kinase family, STE20 subfamily
Function
Serine/threonine protein kinase that plays a role in the regulation of gene transcription. The kinase activity is induced by various effectors including AR or MAP2K6/MAPKK6. Phosphorylates the DNA-binding domain of androgen receptor/AR and thereby inhibits AR-mediated transcription. Inhibits also ESR1-mediated transcription. May play a role in cytoskeleton regulation by interacting with IQGAP1. May protect cells from apoptosis through phosphorylation of BAD.
    Click to Show/Hide
Gene ID 1.07E+13
Uniprot ID
PAK6_HUMAN
HGNC ID
HGNC:16061
KEGG ID
hsa:106821730hsa:56924
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03117
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Cervical cancer
 Disease Info 
Crosstalk ID: M6ACROT03119
 Crosstalk Info 
Epigenetic Regulator WD repeat-containing protein 5 (WDR5)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Cervical cancer
 Disease Info 
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03118
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Cervical cancer
 Disease Info 
Crosstalk ID: M6ACROT03120
 Crosstalk Info 
Epigenetic Regulator WD repeat-containing protein 5 (WDR5)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Cervical cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00892)
Serine/threonine-protein kinase PAK 6 (PAK5)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010484 Click to Show/Hide the Full List
mod site chr20:9806944-9806945:- [2]
Sequence AGAGGCTGAAGAAGGCAAGGAAATGGATTCTGTCCTTGGGC
Transcript ID List ENST00000353224.9; ENST00000378423.5; ENST00000378429.3; rmsk_5065500
External Link RMBase: RNA-editing_site_85651
N6-methyladenosine (m6A)
In total 10 m6A sequence/site(s) in this target gene
mod ID: M6ASITE051509 Click to Show/Hide the Full List
mod site chr20:9538228-9538229:- [3]
Sequence CATGTTATAATGTGTTTCCGACATAGGAGAGTCGTGCTGCT
Motif Score 2.865571429
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000378423.5; ENST00000353224.9; ENST00000378429.3
External Link RMBase: m6A_site_522963
mod ID: M6ASITE051510 Click to Show/Hide the Full List
mod site chr20:9539386-9539387:- [4]
Sequence AGAACAAAAGGAAACACAGAACATGCAAAAGGCCTGTGCAT
Motif Score 2.951386905
Cell/Tissue List H1B; H1A
Seq Type List m6A-seq
Transcript ID List ENST00000378423.5; ENST00000353224.9; ENST00000378429.3
External Link RMBase: m6A_site_522964
mod ID: M6ASITE051511 Click to Show/Hide the Full List
mod site chr20:9539393-9539394:- [4]
Sequence ATTCAGGAGAACAAAAGGAAACACAGAACATGCAAAAGGCC
Motif Score 2.20572619
Cell/Tissue List H1B; H1A
Seq Type List m6A-seq
Transcript ID List ENST00000353224.9; ENST00000378429.3; ENST00000378423.5
External Link RMBase: m6A_site_522965
mod ID: M6ASITE051512 Click to Show/Hide the Full List
mod site chr20:9539403-9539404:- [4]
Sequence CATGAGAATAATTCAGGAGAACAAAAGGAAACACAGAACAT
Motif Score 2.951386905
Cell/Tissue List H1B; H1A
Seq Type List m6A-seq
Transcript ID List ENST00000378429.3; ENST00000378423.5; ENST00000353224.9
External Link RMBase: m6A_site_522966
mod ID: M6ASITE051513 Click to Show/Hide the Full List
mod site chr20:9539424-9539425:- [4]
Sequence GGTGGCAAAGCTAGATGAGGACATGAGAATAATTCAGGAGA
Motif Score 3.643047619
Cell/Tissue List H1B
Seq Type List m6A-seq
Transcript ID List ENST00000378429.3; ENST00000353224.9; ENST00000378423.5
External Link RMBase: m6A_site_522967
mod ID: M6ASITE051514 Click to Show/Hide the Full List
mod site chr20:9539479-9539480:- [4]
Sequence TGCATCGTCCCCCTCATGAGACAATACAGGCATCACTGAGC
Motif Score 2.897386905
Cell/Tissue List H1B
Seq Type List m6A-seq
Transcript ID List ENST00000378429.3; ENST00000353224.9; ENST00000378423.5
External Link RMBase: m6A_site_522968
mod ID: M6ASITE051515 Click to Show/Hide the Full List
mod site chr20:9580308-9580309:- [4]
Sequence AGTCTTCGTACCTGAATCAGACAAGCCCTCAGCCCACCATG
Motif Score 2.897386905
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000378423.5; ENST00000378429.3; ENST00000353224.9
External Link RMBase: m6A_site_522969
mod ID: M6ASITE051517 Click to Show/Hide the Full List
mod site chr20:9580360-9580361:- [4]
Sequence TACAGTGAAAGTGAATGGGGACCCAGCCTGGATGACTATGA
Motif Score 3.622404762
Cell/Tissue List H1B; H1A
Seq Type List m6A-seq
Transcript ID List ENST00000353224.9; ENST00000378429.3; ENST00000378423.5
External Link RMBase: m6A_site_522970
mod ID: M6ASITE051518 Click to Show/Hide the Full List
mod site chr20:9580410-9580411:- [4]
Sequence CACCTTCTAGAACTGCAGGGACCAGCGGGTGCTCCAAGGAG
Motif Score 3.622404762
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000378429.3; ENST00000353224.9; ENST00000378423.5
External Link RMBase: m6A_site_522971
mod ID: M6ASITE051519 Click to Show/Hide the Full List
mod site chr20:9580419-9580420:- [4]
Sequence TCCAATTCACACCTTCTAGAACTGCAGGGACCAGCGGGTGC
Motif Score 3.373380952
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000378423.5; ENST00000378429.3; ENST00000353224.9
External Link RMBase: m6A_site_522972