m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00842)

Target Name	Vacuolar protein sorting-associated protein 33B (VPS33B)
Synonyms	hVPS33B Click to Show/Hide
Gene Name	VPS33B
Chromosomal Location	15q26.1
Family	STXBP/unc-18/SEC1 family
Function	May play a role in vesicle-mediated protein trafficking to lysosomal compartments and in membrane docking/fusion reactions of late endosomes/lysosomes. Required for proper trafficking and targeting of the collagen-modifying enzyme lysyl hydroxylase 3 (LH3) to intracellular collagen (PubMed:28017832). Mediates phagolysosomal fusion in macrophages (PubMed:18474358). Proposed to be involved in endosomal maturation implicating VIPAS39. In epithelial cells, the VPS33B:VIPAS39 complex may play a role in the apical recycling pathway and in the maintenance of the apical-basolateral polarity (PubMed:20190753). Seems to be involved in the sorting of specific cargos from the trans-Golgi network to alpha-granule-destined multivesicular bodies (MVBs) promoting MVBs maturation in megakaryocytes (By similarity). Click to Show/Hide
Gene ID	26276
Uniprot ID	VP33B_HUMAN
HGNC ID	HGNC:12712
KEGG ID	hsa:26276

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00842)

Vacuolar protein sorting-associated protein 33B (VPS33B)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000486		Click to Show/Hide the Full List
mod site	chr15:91002135-91002136:-		[2]
Sequence	CTTCTCCAATCTGCGAAGAGCTGGGCTCCTAACGGAGCAGG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000333371.7; ENST00000643536.1; ENST00000574755.5; ENST00000535906.1; ENST00000647331.1
External Link	RMBase: m5C_site_14542

N6-methyladenosine (m6A)

In total 29 m6A sequence/site(s) in this target gene
mod ID: M6ASITE024734		Click to Show/Hide the Full List
mod site	chr15:90998767-90998768:-		[3]
Sequence	CTCTTTTCTGTTTATGAAGTACAACCCATGCTGCTAAGATG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000647331.1; ENST00000643536.1; ENST00000557470.5; ENST00000333371.7; ENST00000574755.5; ENST00000535906.1
External Link	RMBase: m6A_site_295785
mod ID: M6ASITE024735		Click to Show/Hide the Full List
mod site	chr15:90998831-90998832:-		[4]
Sequence	AACGTGTTGGGATTTAGAGAACATTATCTGAGAAAAGAGTT
Motif Score	2.951386905
Cell/Tissue List	HeLa; brain; kidney; hESC-HEK293T; A549
Seq Type List	m6A-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000535906.1; ENST00000647331.1; ENST00000574755.5; ENST00000557470.5; ENST00000333371.7; ENST00000643536.1
External Link	RMBase: m6A_site_295786
mod ID: M6ASITE024736		Click to Show/Hide the Full List
mod site	chr15:90999721-90999722:-		[3]
Sequence	TGGTGTTCTTGGGTGGTTGTACATTCTCTGAGATCTCAGCC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000535906.1; ENST00000554660.1; ENST00000557470.5; ENST00000333371.7; ENST00000647331.1; ENST00000643536.1; ENST00000574755.5
External Link	RMBase: m6A_site_295787
mod ID: M6ASITE024737		Click to Show/Hide the Full List
mod site	chr15:90999777-90999778:-		[4]
Sequence	CACAGATATGACTAAGGAAGACAAGGCTTCCAGTGAGTCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000535906.1; ENST00000647331.1; ENST00000554660.1; ENST00000643536.1; ENST00000574755.5; ENST00000333371.7; ENST00000557470.5
External Link	RMBase: m6A_site_295788
mod ID: M6ASITE024738		Click to Show/Hide the Full List
mod site	chr15:91002105-91002106:-		[5]
Sequence	AACGGAGCAGGCCCCCGGGGACACCCTCACAGCCGTGGAGA
Motif Score	3.643047619
Cell/Tissue List	HepG2; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000643536.1; ENST00000574755.5; ENST00000333371.7; ENST00000535906.1; ENST00000647331.1
External Link	RMBase: m6A_site_295789
mod ID: M6ASITE024739		Click to Show/Hide the Full List
mod site	chr15:91003098-91003099:-		[3]
Sequence	AGGATTACCGATCTCTGAAAACACAGTATCTGCAGGTAAGG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000574755.5; ENST00000333371.7; ENST00000647331.1; ENST00000643536.1; ENST00000535906.1
External Link	RMBase: m6A_site_295790
mod ID: M6ASITE024740		Click to Show/Hide the Full List
mod site	chr15:91005418-91005419:-		[6]
Sequence	AATCCATCATGAAGAAGAAAACCAAGCAGGATTTCCAGGAG
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000647331.1; ENST00000333371.7; ENST00000643536.1; ENST00000574755.5; ENST00000535906.1
External Link	RMBase: m6A_site_295791
mod ID: M6ASITE024741		Click to Show/Hide the Full List
mod site	chr15:91005767-91005768:-		[3]
Sequence	ACAGCGCCGGAGAGGCATGGACATTAAGCAGATGAAGAATT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000643536.1; ENST00000647331.1; ENST00000574755.5; ENST00000535906.1; ENST00000333371.7
External Link	RMBase: m6A_site_295792
mod ID: M6ASITE024742		Click to Show/Hide the Full List
mod site	chr15:91006375-91006376:-		[7]
Sequence	GGTGCTACTCAATGCCGAGGACAAGGTGAGGGTGTGGGTGC
Motif Score	3.643047619
Cell/Tissue List	HEK293; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000535906.1; ENST00000647331.1; ENST00000333371.7; ENST00000574755.5; ENST00000643536.1; ENST00000556096.6
External Link	RMBase: m6A_site_295793
mod ID: M6ASITE024743		Click to Show/Hide the Full List
mod site	chr15:91006722-91006723:-		[4]
Sequence	GATCTCTGTTTCAGATGTGGACTTTGTGACAGCACTTTGCT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000574755.5; ENST00000643536.1; ENST00000535906.1; ENST00000647331.1; ENST00000333371.7; ENST00000556096.6
External Link	RMBase: m6A_site_295794
mod ID: M6ASITE024744		Click to Show/Hide the Full List
mod site	chr15:91006757-91006758:-		[4]
Sequence	AGAAGGCTGGGTCAGGGAGAACCTTCATGGTCAGGGATCTC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000556096.6; ENST00000535906.1; ENST00000647331.1; ENST00000643536.1; ENST00000333371.7; ENST00000574755.5
External Link	RMBase: m6A_site_295795
mod ID: M6ASITE024745		Click to Show/Hide the Full List
mod site	chr15:91006788-91006789:-		[4]
Sequence	AGTATCAAAGCTGCCCTTGGACATGCTGTGTAGAAGGCTGG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000647331.1; ENST00000574755.5; ENST00000643536.1; ENST00000333371.7; ENST00000556096.6; ENST00000535906.1
External Link	RMBase: m6A_site_295796
mod ID: M6ASITE024746		Click to Show/Hide the Full List
mod site	chr15:91006997-91006998:-		[4]
Sequence	AGGAGGAGGAGGATGGCGAAACCAAGGGCCGAAGGCCAGAG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000647331.1; ENST00000333371.7; ENST00000556096.6; ENST00000643536.1; ENST00000535906.1; ENST00000574755.5
External Link	RMBase: m6A_site_295797
mod ID: M6ASITE024747		Click to Show/Hide the Full List
mod site	chr15:91007023-91007024:-		[4]
Sequence	GGCATATGAATTGTGGAGGAACCTGGAGGAGGAGGAGGATG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000556096.6; ENST00000574755.5; ENST00000333371.7; ENST00000643536.1; ENST00000647331.1; ENST00000535906.1
External Link	RMBase: m6A_site_295798
mod ID: M6ASITE024748		Click to Show/Hide the Full List
mod site	chr15:91007496-91007497:-		[4]
Sequence	TCTCTATGGACCCTTTCCAAACTGCTATGGAATTGGCAGGT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000574755.5; ENST00000643536.1; ENST00000333371.7; ENST00000647331.1; ENST00000535906.1; ENST00000556096.6
External Link	RMBase: m6A_site_295799
mod ID: M6ASITE024749		Click to Show/Hide the Full List
mod site	chr15:91007507-91007508:-		[4]
Sequence	CTTCTCAGCACTCTCTATGGACCCTTTCCAAACTGCTATGG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000574755.5; ENST00000643536.1; ENST00000556096.6; ENST00000535906.1; ENST00000647331.1; ENST00000333371.7
External Link	RMBase: m6A_site_295800
mod ID: M6ASITE024750		Click to Show/Hide the Full List
mod site	chr15:91007531-91007532:-		[3]
Sequence	AACACTGTAGCTCAGGCCTTACACCTTCTCAGCACTCTCTA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000574755.5; ENST00000647331.1; ENST00000333371.7; ENST00000643536.1; ENST00000556096.6; ENST00000535906.1
External Link	RMBase: m6A_site_295801
mod ID: M6ASITE024751		Click to Show/Hide the Full List
mod site	chr15:91007550-91007551:-		[3]
Sequence	AGGAGATCAGCGTTGGATCAACACTGTAGCTCAGGCCTTAC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000535906.1; ENST00000333371.7; ENST00000556096.6; ENST00000574755.5; ENST00000643536.1; ENST00000647331.1
External Link	RMBase: m6A_site_295802
mod ID: M6ASITE024752		Click to Show/Hide the Full List
mod site	chr15:91007899-91007900:-		[4]
Sequence	GTGGATCTGCTGAGCATGGAACTACCAGAATTTTTCAGGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000574755.5; ENST00000647331.1; ENST00000556096.6; ENST00000643536.1; ENST00000535906.1; ENST00000333371.7
External Link	RMBase: m6A_site_295803
mod ID: M6ASITE024753		Click to Show/Hide the Full List
mod site	chr15:91013828-91013829:-		[3]
Sequence	GGCTGGCCGAACTCGCAAATACAAAGTGATCTTCAGCCCTC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000535906.1; ENST00000557358.1; ENST00000556096.6; ENST00000647331.1; ENST00000333371.7; ENST00000554264.5; ENST00000643536.1; ENST00000574755.5
External Link	RMBase: m6A_site_295804
mod ID: M6ASITE024754		Click to Show/Hide the Full List
mod site	chr15:91013838-91013839:-		[4]
Sequence	CTGACAAATTGGCTGGCCGAACTCGCAAATACAAAGTGATC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000556096.6; ENST00000574755.5; ENST00000557358.1; ENST00000554264.5; ENST00000333371.7; ENST00000647331.1; ENST00000535906.1; ENST00000643536.1
External Link	RMBase: m6A_site_295805
mod ID: M6ASITE024755		Click to Show/Hide the Full List
mod site	chr15:91014414-91014415:-		[4]
Sequence	AGATTGTGCTTCTTGGTCAGACCCCGCATCAAGAATATGCG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000647331.1; ENST00000333371.7; ENST00000556096.6; ENST00000643536.1; ENST00000574755.5; ENST00000557358.1; ENST00000554264.5; ENST00000535906.1
External Link	RMBase: m6A_site_295806
mod ID: M6ASITE024756		Click to Show/Hide the Full List
mod site	chr15:91016964-91016965:-		[4]
Sequence	CCAGCCCTCAGCTCCAATGAACAGTGAGTGTCTGGGAGAGT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000554264.5; ENST00000535906.1; ENST00000574755.5; ENST00000333371.7; ENST00000556096.6; ENST00000647331.1; ENST00000643536.1; ENST00000557358.1
External Link	RMBase: m6A_site_295807
mod ID: M6ASITE024757		Click to Show/Hide the Full List
mod site	chr15:91016989-91016990:-		[4]
Sequence	CAAGCTATACAAGGTGGAGAACAAGCCAGCCCTCAGCTCCA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000647331.1; ENST00000643536.1; ENST00000535906.1; ENST00000574755.5; ENST00000554264.5; ENST00000556096.6; ENST00000557358.1; ENST00000333371.7
External Link	RMBase: m6A_site_295808
mod ID: M6ASITE024758		Click to Show/Hide the Full List
mod site	chr15:91017010-91017011:-		[4]
Sequence	TCTGTAGCAACACGAAGTAGACAAGCTATACAAGGTGGAGA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000554264.5; ENST00000557358.1; ENST00000647331.1; ENST00000556096.6; ENST00000333371.7; ENST00000643536.1; ENST00000535906.1; ENST00000574755.5
External Link	RMBase: m6A_site_295809
mod ID: M6ASITE024759		Click to Show/Hide the Full List
mod site	chr15:91022178-91022179:-		[4]
Sequence	GCTGAAGAGGCTGGCTCGAGACCAGCTCATCTATCTGCTGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000643536.1; ENST00000647331.1; ENST00000574755.5; ENST00000535906.1; ENST00000333371.7; ENST00000557358.1; ENST00000556096.6
External Link	RMBase: m6A_site_295810
mod ID: M6ASITE024760		Click to Show/Hide the Full List
mod site	chr15:91022454-91022455:-		[4]
Sequence	ACGGTGGCTGCAGGTCTGAGACAAGGCTGCTCCGAGGTAGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000333371.7; ENST00000535906.1; ENST00000643536.1; ENST00000557358.1; ENST00000574755.5; ENST00000556096.6
External Link	RMBase: m6A_site_295811
mod ID: M6ASITE024761		Click to Show/Hide the Full List
mod site	chr15:91022476-91022477:-		[4]
Sequence	ATCAGGGAGGGAGGGTCGAGACACGGTGGCTGCAGGTCTGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000535906.1; ENST00000557358.1; ENST00000556096.6; ENST00000643536.1; ENST00000574755.5; ENST00000333371.7
External Link	RMBase: m6A_site_295812
mod ID: M6ASITE024762		Click to Show/Hide the Full List
mod site	chr15:91022524-91022525:-		[4]
Sequence	GGAGTCTCTGCGGGGTGTAGACCGGAATCCTGCTGACGGGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000556096.6; ENST00000333371.7; ENST00000643536.1; ENST00000557358.1; ENST00000535906.1
External Link	RMBase: m6A_site_295813

Ref 1	Down-regulation of survivin in nitric oxide-induced cell growth inhibition and apoptosis of the human lung carcinoma cells. J Biol Chem. 2004 May 7;279(19):20267-76. doi: 10.1074/jbc.M312381200. Epub 2004 Feb 26.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 6	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map