m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00829)

Target Name	Glutathione peroxidase 1 (GPX1)
Synonyms	GPx-1; GSHPx-1; EC 1.11.1.9; Cellular glutathione peroxidase; Phospholipid-hydroperoxide glutathione peroxidase GPX1; EC 1.11.1.12 Click to Show/Hide
Gene Name	GPX1
Chromosomal Location	3p21.31
Family	Glutathione peroxidase family
Function	Catalyzes the reduction of hydroperoxides in a glutathione-dependent manner thus regulating cellular redox homeostasis (PubMed:11115402, PubMed:36608588). Can reduce small soluble hydroperoxides such as H2O2, cumene hydroperoxide and tert-butyl hydroperoxide, as well as several fatty acid-derived hydroperoxides (PubMed:11115402, PubMed:36608588). In platelets catalyzes the reduction of 12-hydroperoxyeicosatetraenoic acid, the primary product of the arachidonate 12-lipoxygenase pathway (PubMed:11115402). Click to Show/Hide
Gene ID	2876
Uniprot ID	GPX1_HUMAN
HGNC ID	HGNC:4553
KEGG ID	hsa:2876

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00829)

Glutathione peroxidase 1 (GPX1)

2'-O-Methylation (2'-O-Me)

In total 4 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000310		Click to Show/Hide the Full List
mod site	chr3:49357715-49357716:-		[2]
Sequence	GAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000651740.1; ENST00000643797.1; ENST00000419783.3; ENST00000496791.1; ENST00000620890.1; ENST00000646881.1; ENST00000419349.2
External Link	RMBase: Nm_site_4943
mod ID: 2OMSITE000308		Click to Show/Hide the Full List
mod site	chr3:49357277-49357278:-		[2]
Sequence	GAGGGAGGAACACCTGATCTTACAGAAAATACCACCTCGAG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000620890.1; ENST00000419349.2; ENST00000419783.3; ENST00000643797.1
External Link	RMBase: Nm_site_4941
mod ID: 2OMSITE000309		Click to Show/Hide the Full List
mod site	chr3:49357712-49357713:-		[2]
Sequence	CGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTGGTG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000419349.2; ENST00000620890.1; ENST00000643797.1; ENST00000651740.1; ENST00000496791.1; ENST00000419783.3; ENST00000646881.1
External Link	RMBase: Nm_site_4942
mod ID: 2OMSITE000311		Click to Show/Hide the Full List
mod site	chr3:49357716-49357717:-		[2]
Sequence	AGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000620890.1; ENST00000419783.3; ENST00000651740.1; ENST00000646881.1; ENST00000496791.1; ENST00000419349.2; ENST00000643797.1
External Link	RMBase: Nm_site_4944

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003097		Click to Show/Hide the Full List
mod site	chr3:49357626-49357627:-		[3]
Sequence	ACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGGAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000646881.1; ENST00000620890.1; ENST00000651740.1; ENST00000419783.3; ENST00000643797.1; ENST00000496791.1; ENST00000419349.2
External Link	RMBase: m5C_site_32170
mod ID: M5CSITE003098		Click to Show/Hide the Full List
mod site	chr3:49357628-49357629:-		[3]
Sequence	GAACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000419349.2; ENST00000646881.1; ENST00000496791.1; ENST00000620890.1; ENST00000419783.3; ENST00000651740.1; ENST00000643797.1
External Link	RMBase: m5C_site_32171
mod ID: M5CSITE003099		Click to Show/Hide the Full List
mod site	chr3:49358019-49358020:-		[3]
Sequence	AGTTTGGGCATCAGGTGCGCCGGGCGGAGCGGGGCGGGGCG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000651740.1; ENST00000496791.1; ENST00000646881.1; ENST00000620890.1; ENST00000651279.1; ENST00000643797.1; ENST00000419783.3; ENST00000419349.2
External Link	RMBase: m5C_site_32172

N6-methyladenosine (m6A)

In total 12 m6A sequence/site(s) in this target gene
mod ID: M6ASITE061073		Click to Show/Hide the Full List
mod site	chr3:49357220-49357221:-		[4]
Sequence	TTGATCCCAGTCTCTGCCAGACCAAGGCGAGTTTCCCCACT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000419349.2; ENST00000620890.1; ENST00000643797.1; ENST00000419783.3
External Link	RMBase: m6A_site_590366
mod ID: M6ASITE061074		Click to Show/Hide the Full List
mod site	chr3:49357276-49357277:-		[5]
Sequence	AGGGAGGAACACCTGATCTTACAGAAAATACCACCTCGAGA
Motif Score	2.07285119
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000419349.2; ENST00000643797.1; ENST00000419783.3; ENST00000620890.1
External Link	RMBase: m6A_site_590367
mod ID: M6ASITE061075		Click to Show/Hide the Full List
mod site	chr3:49357288-49357289:-		[4]
Sequence	TCTAAACCTACGAGGGAGGAACACCTGATCTTACAGAAAAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000620890.1; ENST00000419783.3; ENST00000419349.2; ENST00000643797.1
External Link	RMBase: m6A_site_590368
mod ID: M6ASITE061076		Click to Show/Hide the Full List
mod site	chr3:49357303-49357304:-		[4]
Sequence	TATGAGGGTGTTTCCTCTAAACCTACGAGGGAGGAACACCT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000620890.1; ENST00000643797.1; ENST00000419783.3; ENST00000419349.2
External Link	RMBase: m6A_site_590369
mod ID: M6ASITE061078		Click to Show/Hide the Full List
mod site	chr3:49357427-49357428:-		[6]
Sequence	GACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000419349.2; ENST00000643797.1; ENST00000419783.3; ENST00000620890.1
External Link	RMBase: m6A_site_590370
mod ID: M6ASITE061079		Click to Show/Hide the Full List
mod site	chr3:49357439-49357440:-		[5]
Sequence	CCGCCGCTTCCAGACCATTGACATCGAGCCTGACATCGAAG
Motif Score	2.859755952
Cell/Tissue List	HEK293; liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000419349.2; ENST00000643797.1; ENST00000620890.1; ENST00000419783.3
External Link	RMBase: m6A_site_590371
mod ID: M6ASITE061080		Click to Show/Hide the Full List
mod site	chr3:49357446-49357447:-		[4]
Sequence	GGTACAGCCGCCGCTTCCAGACCATTGACATCGAGCCTGAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000419783.3; ENST00000620890.1; ENST00000419349.2; ENST00000643797.1
External Link	RMBase: m6A_site_590372
mod ID: M6ASITE061081		Click to Show/Hide the Full List
mod site	chr3:49357511-49357512:-		[4]
Sequence	TCGCAACGATGTTGCCTGGAACTTTGAGAAGTTCCTGGTGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; MM6; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000419349.2; ENST00000646881.1; ENST00000620890.1; ENST00000419783.3; ENST00000643797.1; ENST00000651740.1
External Link	RMBase: m6A_site_590373
mod ID: M6ASITE061082		Click to Show/Hide the Full List
mod site	chr3:49358077-49358078:-		[7]
Sequence	GAGCTGCAGCGGCGCCTCGGACCCCGGGGCCTGGTGGTGCT
Motif Score	3.622404762
Cell/Tissue List	HepG2; A549; MM6; HEK293T; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000620890.1; ENST00000419349.2; ENST00000646881.1; ENST00000419783.3; ENST00000643797.1; ENST00000496791.1; ENST00000651740.1; ENST00000651279.1
External Link	RMBase: m6A_site_590374
mod ID: M6ASITE061083		Click to Show/Hide the Full List
mod site	chr3:49358111-49358112:-		[6]
Sequence	AGGCACCACGGTCCGGGACTACACCCAGATGAACGAGCTGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000646881.1; ENST00000419783.3; ENST00000496791.1; ENST00000651279.1; ENST00000651740.1; ENST00000419349.2; ENST00000643797.1; ENST00000620890.1
External Link	RMBase: m6A_site_590375
mod ID: M6ASITE061084		Click to Show/Hide the Full List
mod site	chr3:49358114-49358115:-		[7]
Sequence	CTGAGGCACCACGGTCCGGGACTACACCCAGATGAACGAGC
Motif Score	4.065041667
Cell/Tissue List	HepG2; HeLa; A549; MM6; HEK293T; MSC; iSLK; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000419783.3; ENST00000651279.1; ENST00000646881.1; ENST00000643797.1; ENST00000419349.2; ENST00000651740.1; ENST00000496791.1; ENST00000620890.1
External Link	RMBase: m6A_site_590376
mod ID: M6ASITE061085		Click to Show/Hide the Full List
mod site	chr3:49358288-49358289:-		[4]
Sequence	GCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTG
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; HepG2; A549; MM6; HEK293A-TOA; MSC; TIME; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000620890.1; ENST00000643797.1; ENST00000419783.3; ENST00000496791.1; ENST00000419349.2; ENST00000646881.1
External Link	RMBase: m6A_site_590377

Ref 1	GEMSTONE-301: a phase III clinical trial of CS1001 as consolidation therapy in patients with locally advanced/unresectable (stage III) non-small cell lung cancer (NSCLC) who did not have disease progression after prior concurrent/sequential chemoradiotherapy. Transl Lung Cancer Res. 2020 Oct;9(5):2008-2015. doi: 10.21037/tlcr-20-608.
Ref 2	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map