m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00822)
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00822)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE066150 | Click to Show/Hide the Full List | ||
| mod site | chr4:73412059-73412060:+ | [2] | |
| Sequence | CAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAAGTCCAC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000415165.6; ENST00000507673.1; ENST00000511370.1; ENST00000476441.6; ENST00000621628.4; ENST00000401494.7; ENST00000505649.5; ENST00000295897.9; ENST00000509063.5; ENST00000621085.4; ENST00000503124.5 | ||
| External Link | RMBase: m6A_site_640235 | ||
| mod ID: M6ASITE066151 | Click to Show/Hide the Full List | ||
| mod site | chr4:73418178-73418179:+ | [2] | |
| Sequence | CTGCACAGAATCCTTGGTGAACAGGCGACCATGCTTTTCAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000509063.5; ENST00000505649.5; ENST00000401494.7; ENST00000621628.4; ENST00000621085.4; ENST00000476441.6; ENST00000415165.6; ENST00000511370.1; ENST00000486939.1; ENST00000295897.9; ENST00000503124.5 | ||
| External Link | RMBase: m6A_site_640236 | ||
References