General Information of the m6A Target Gene (ID: M6ATAR00822)
Target Name Albumin (ALB)
Gene Name ALB
Chromosomal Location 4q13.3
Family ALB/AFP/VDB family
Function
Binds water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs (Probable). Its main function is the regulation of the colloidal osmotic pressure of blood (Probable). Major zinc transporter in plasma, typically binds about 80% of all plasma zinc (PubMed:19021548). Major calcium and magnesium transporter in plasma, binds approximately 45% of circulating calcium and magnesium in plasma (By similarity). Potentially has more than two calcium-binding sites and might additionally bind calcium in a non-specific manner (By similarity). The shared binding site between zinc and calcium at residue Asp-273 suggests a crosstalk between zinc and calcium transport in the blood (By similarity). The rank order of affinity is zinc > calcium > magnesium (By similarity). Binds to the bacterial siderophore enterobactin and inhibits enterobactin-mediated iron uptake of E.coli from ferric transferrin, and may thereby limit the utilization of iron and growth of enteric bacteria such as E.coli (PubMed:6234017). Does not prevent iron uptake by the bacterial siderophore aerobactin (PubMed:6234017).
    Click to Show/Hide
Gene ID 213
Uniprot ID
ALBU_HUMAN
HGNC ID
HGNC:399
KEGG ID
hsa:213
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00822)
Albumin (ALB)
N6-methyladenosine (m6A)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M6ASITE066150 Click to Show/Hide the Full List
mod site chr4:73412059-73412060:+ [2]
Sequence CAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAAGTCCAC
Motif Score 2.859755952
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000415165.6; ENST00000507673.1; ENST00000511370.1; ENST00000476441.6; ENST00000621628.4; ENST00000401494.7; ENST00000505649.5; ENST00000295897.9; ENST00000509063.5; ENST00000621085.4; ENST00000503124.5
External Link RMBase: m6A_site_640235
mod ID: M6ASITE066151 Click to Show/Hide the Full List
mod site chr4:73418178-73418179:+ [2]
Sequence CTGCACAGAATCCTTGGTGAACAGGCGACCATGCTTTTCAG
Motif Score 2.951386905
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000509063.5; ENST00000505649.5; ENST00000401494.7; ENST00000621628.4; ENST00000621085.4; ENST00000476441.6; ENST00000415165.6; ENST00000511370.1; ENST00000486939.1; ENST00000295897.9; ENST00000503124.5
External Link RMBase: m6A_site_640236