m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00809)

Target Name	X-ray repair cross-complementing protein 5 (XRCC5)
Synonyms	EC 3.6.4.-; 86 kDa subunit of Ku antigen; ATP-dependent DNA helicase 2 subunit 2; ATP-dependent DNA helicase II 80 kDa subunit; CTC box-binding factor 85 kDa subunit; CTC85; CTCBF; DNA repair protein XRCC5; Ku80; Ku86; Lupus Ku autoantigen protein p86; Nuclear factor IV; Thyroid-lupus autoantigen; TLAA; X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining Click to Show/Hide
Gene Name	XRCC5
Chromosomal Location	2q35
Family	Ku80 family
Function	Single-stranded DNA-dependent ATP-dependent helicase that plays a key role in DNA non-homologous end joining (NHEJ) by recruiting DNA-PK to DNA (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:11493912). Required for double-strand break repair and V(D)J recombination (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:11493912). Also has a role in chromosome translocation (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:11493912). The DNA helicase II complex binds preferentially to fork-like ends of double-stranded DNA in a cell cycle-dependent manner (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:11493912). It works in the 3'-5' direction (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:11493912). During NHEJ, the XRCC5-XRRC6 dimer performs the recognition step: it recognizes and binds to the broken ends of the DNA and protects them from further resection (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:11493912). Binding to DNA may be mediated by XRCC6 (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:11493912). The XRCC5-XRRC6 dimer acts as a regulatory subunit of the DNA-dependent protein kinase complex DNA-PK by increasing the affinity of the catalytic subunit PRKDC to DNA by 100-fold (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:20383123, PubMed:11493912). The XRCC5-XRRC6 dimer is probably involved in stabilizing broken DNA ends and bringing them together (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:20383123). The assembly of the DNA-PK complex to DNA ends is required for the NHEJ ligation step (PubMed:7957065, PubMed:8621488, PubMed:12145306, PubMed:20383123). The XRCC5-XRRC6 dimer probably also acts as a 5'-deoxyribose-5-phosphate lyase (5'-dRP lyase), by catalyzing the beta-elimination of the 5' deoxyribose-5-phosphate at an abasic site near double-strand breaks (PubMed:20383123). XRCC5 probably acts as the catalytic subunit of 5'-dRP activity, and allows to 'clean' the termini of abasic sites, a class of nucleotide damage commonly associated with strand breaks, before such broken ends can be joined (PubMed:20383123). The XRCC5-XRRC6 dimer together with APEX1 acts as a negative regulator of transcription (PubMed:8621488). In association with NAA15, the XRCC5-XRRC6 dimer binds to the osteocalcin promoter and activates osteocalcin expression (PubMed:12145306). As part of the DNA-PK complex, involved in the early steps of ribosome assembly by promoting the processing of precursor rRNA into mature 18S rRNA in the small-subunit processome (PubMed:32103174). Binding to U3 small nucleolar RNA, recruits PRKDC and XRCC5/Ku86 to the small-subunit processome (PubMed:32103174). Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway (PubMed:28712728). Click to Show/Hide
Gene ID	7520
Uniprot ID	XRCC5_HUMAN
HGNC ID	HGNC:12833
KEGG ID	hsa:7520

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00809)

X-ray repair cross-complementing protein 5 (XRCC5)

Adenosine-to-Inosine editing (A-to-I)

In total 7 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010241		Click to Show/Hide the Full List
mod site	chr2:216123694-216123695:+		[2]
Sequence	GCATGCCTGTAGTCCTAGCTACTTGAGAGGCTGAGGCAAGT
Transcript ID List	ENST00000460284.5; rmsk_817181; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: RNA-editing_site_83484
mod ID: A2ISITE010242		Click to Show/Hide the Full List
mod site	chr2:216153430-216153431:+		[3]
Sequence	TTTATTGAACCTTATGCTGAAGATAATGGGAAGCCATTAAA
Transcript ID List	ENST00000460284.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: RNA-editing_site_83485
mod ID: A2ISITE010243		Click to Show/Hide the Full List
mod site	chr2:216153477-216153478:+		[2]
Sequence	GTTTTTAATCAGGGTTCCAAAGATTGATATCAAGGAATCTG
Transcript ID List	ENST00000392133.7; ENST00000460284.5; rmsk_817233; ENST00000392132.7
External Link	RMBase: RNA-editing_site_83486
mod ID: A2ISITE010244		Click to Show/Hide the Full List
mod site	chr2:216154744-216154745:+		[2]
Sequence	CTAAGTTTTGAAGTTTGGATATAATTTCTGGTAGTTCACAG
Transcript ID List	ENST00000392132.7; ENST00000460284.5; ENST00000392133.7
External Link	RMBase: RNA-editing_site_83487
mod ID: A2ISITE010245		Click to Show/Hide the Full List
mod site	chr2:216154761-216154762:+		[3]
Sequence	GATATAATTTCTGGTAGTTCACAGATTCCTTGATGTCATCT
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7
External Link	RMBase: RNA-editing_site_83488
mod ID: A2ISITE010246		Click to Show/Hide the Full List
mod site	chr2:216169652-216169653:+		[2]
Sequence	CCCTTGCCTGGCATGGCCTTAGGTCCTGTTTACTACAGTTT
Transcript ID List	ENST00000460284.5; ENST00000392132.7; ENST00000392133.7
External Link	RMBase: RNA-editing_site_83489
mod ID: A2ISITE010247		Click to Show/Hide the Full List
mod site	chr2:216180449-216180450:+		[2]
Sequence	AGCCTAGCCAACATGGCAAAACCCCATCTCTACTAAAAATA
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000460284.5; rmsk_817279
External Link	RMBase: RNA-editing_site_83490

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002514		Click to Show/Hide the Full List
mod site	chr2:216109364-216109365:+		[4]
Sequence	TCCGCTATCTGCCGCTTGTCCACCGGAAGCGAGTTGCGACA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000392132.7; ENST00000417391.1; ENST00000392133.7; ENST00000429133.5; ENST00000476360.1
External Link	RMBase: m5C_site_27829
mod ID: M5CSITE002515		Click to Show/Hide the Full List
mod site	chr2:216113059-216113060:+
Sequence	GTGGGCTTTACCATGAGTAACTCCATTCCTGGTATAGAATC
Cell/Tissue List	frontalcortex
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000476360.1; ENST00000417391.1; ENST00000429133.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m5C_site_27830

N6-methyladenosine (m6A)

In total 92 m6A sequence/site(s) in this target gene
mod ID: M6ASITE050081		Click to Show/Hide the Full List
mod site	chr2:216109382-216109383:+		[5]
Sequence	TCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000476360.1; ENST00000392133.7; ENST00000392132.7; ENST00000417391.1; ENST00000429133.5
External Link	RMBase: m6A_site_509803
mod ID: M6ASITE050082		Click to Show/Hide the Full List
mod site	chr2:216109427-216109428:+		[6]
Sequence	AGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; fibroblasts; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000392133.7; ENST00000417391.1; ENST00000392132.7; ENST00000476360.1; ENST00000429133.5
External Link	RMBase: m6A_site_509804
mod ID: M6ASITE050083		Click to Show/Hide the Full List
mod site	chr2:216109434-216109435:+		[5]
Sequence	AAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000417391.1; ENST00000429133.5; ENST00000392133.7; ENST00000392132.7; ENST00000476360.1
External Link	RMBase: m6A_site_509805
mod ID: M6ASITE050084		Click to Show/Hide the Full List
mod site	chr2:216110475-216110476:+		[6]
Sequence	TCCTCTTTCAGCTGCTGAAAACTTTGTAGCTCTAGTGGAGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; fibroblasts; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000476360.1; ENST00000392133.7; ENST00000417391.1; ENST00000392132.7; ENST00000429133.5
External Link	RMBase: m6A_site_509806
mod ID: M6ASITE050085		Click to Show/Hide the Full List
mod site	chr2:216110515-216110516:+		[6]
Sequence	GAGCTGTTTGTTGCAGATGAACTGGAAGTAAAATTCTAACA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; A549; fibroblasts; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000417391.1; ENST00000429133.5; ENST00000392133.7; ENST00000476360.1; ENST00000392132.7
External Link	RMBase: m6A_site_509807
mod ID: M6ASITE050086		Click to Show/Hide the Full List
mod site	chr2:216113089-216113090:+		[6]
Sequence	GGTATAGAATCCCCATTTGAACAAGCAAAGAAGGTGATAAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T; iSLK
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000429133.5; ENST00000417391.1; ENST00000476360.1
External Link	RMBase: m6A_site_509808
mod ID: M6ASITE050087		Click to Show/Hide the Full List
mod site	chr2:216113119-216113120:+		[7]
Sequence	AAGGTGATAACCATGTTTGTACAGCGACAGGTAAGTTTCAG
Motif Score	2.856142857
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000476360.1; ENST00000429133.5; ENST00000392133.7; ENST00000417391.1; ENST00000451695.5; ENST00000392132.7
External Link	RMBase: m6A_site_509809
mod ID: M6ASITE050088		Click to Show/Hide the Full List
mod site	chr2:216116671-216116672:+		[6]
Sequence	TTTCTAGGTGTTTGCTGAGAACAAGGATGAGATTGCTTTAG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392132.7; ENST00000417391.1; ENST00000451695.5; ENST00000429133.5; ENST00000476360.1; ENST00000392133.7
External Link	RMBase: m6A_site_509810
mod ID: M6ASITE050089		Click to Show/Hide the Full List
mod site	chr2:216116749-216116750:+		[6]
Sequence	TGGTGGGGATCAGTATCAGAACATCACAGTGCACAGACATC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000451695.5; ENST00000392132.7; ENST00000417391.1; ENST00000476360.1; ENST00000392133.7; ENST00000429133.5
External Link	RMBase: m6A_site_509811
mod ID: M6ASITE050090		Click to Show/Hide the Full List
mod site	chr2:216116765-216116766:+		[6]
Sequence	CAGAACATCACAGTGCACAGACATCTGATGCTACCAGATTT
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; AML
Seq Type List	m6A-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000392132.7; ENST00000476360.1; ENST00000429133.5; ENST00000417391.1; ENST00000392133.7; ENST00000451695.5
External Link	RMBase: m6A_site_509812
mod ID: M6ASITE050091		Click to Show/Hide the Full List
mod site	chr2:216116800-216116801:+		[6]
Sequence	AGATTTTGATTTGCTGGAGGACATTGAAAGCAAAATCCAAC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; AML
Seq Type List	m6A-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000451695.5; ENST00000392132.7; ENST00000429133.5; ENST00000392133.7; ENST00000476360.1; ENST00000417391.1
External Link	RMBase: m6A_site_509813
mod ID: M6ASITE050092		Click to Show/Hide the Full List
mod site	chr2:216116865-216116866:+		[6]
Sequence	TCCTTTTTCTGCCAGAGAAGACTTTAAGAAATTTCCTTTAT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000476360.1; ENST00000451695.5; ENST00000429133.5; ENST00000392132.7; ENST00000417391.1; ENST00000392133.7
External Link	RMBase: m6A_site_509814
mod ID: M6ASITE050093		Click to Show/Hide the Full List
mod site	chr2:216116914-216116915:+		[6]
Sequence	TCGTACAGCAGTTTGATGAGACACCCCCAGAGTTTCAGCTA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000451695.5; ENST00000429133.5; ENST00000476360.1; ENST00000460284.5; ENST00000417391.1; ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509815
mod ID: M6ASITE050094		Click to Show/Hide the Full List
mod site	chr2:216117782-216117783:+		[5]
Sequence	GTGAGCATGGATGTGATTCAACATGAAACAATGTAAGTGTT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000460284.5; ENST00000429133.5; ENST00000392133.7; ENST00000392132.7; ENST00000451695.5; ENST00000417391.1
External Link	RMBase: m6A_site_509816
mod ID: M6ASITE050095		Click to Show/Hide the Full List
mod site	chr2:216117789-216117790:+		[6]
Sequence	TGGATGTGATTCAACATGAAACAATGTAAGTGTTCCAAGGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000429133.5; ENST00000392132.7; ENST00000451695.5; ENST00000417391.1; ENST00000460284.5
External Link	RMBase: m6A_site_509817
mod ID: M6ASITE050096		Click to Show/Hide the Full List
mod site	chr2:216119146-216119147:+		[5]
Sequence	TCATAGCTTGAAGAAATGTGACATCTCCCTGCAATTCTTGT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000460284.5; ENST00000451695.5; ENST00000392133.7
External Link	RMBase: m6A_site_509818
mod ID: M6ASITE050097		Click to Show/Hide the Full List
mod site	chr2:216122099-216122100:+		[6]
Sequence	CAAGGAAGATGGAAGTGGGGACAGAGGAGATGGCCCCTTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7
External Link	RMBase: m6A_site_509819
mod ID: M6ASITE050098		Click to Show/Hide the Full List
mod site	chr2:216122166-216122167:+		[6]
Sequence	CCACTAAAAGGAATTACCGAACAGCAAAAAGAAGGTCTTGA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000460284.5
External Link	RMBase: m6A_site_509820
mod ID: M6ASITE050099		Click to Show/Hide the Full List
mod site	chr2:216125931-216125932:+		[6]
Sequence	TTAAGTGAGAGTCTGAGAAAACTGTGCGTCTTCAAGAAAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000460284.5; ENST00000493706.1; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509821
mod ID: M6ASITE050100		Click to Show/Hide the Full List
mod site	chr2:216127559-216127560:+		[6]
Sequence	TACAGGAGAGAGTTAAAAAGACTTGGACAGTTGTGGATGCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000460284.5; ENST00000392132.7; ENST00000493706.1; ENST00000392133.7
External Link	RMBase: m6A_site_509822
mod ID: M6ASITE050101		Click to Show/Hide the Full List
mod site	chr2:216127565-216127566:+		[6]
Sequence	AGAGAGTTAAAAAGACTTGGACAGTTGTGGATGCAAAAACC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; hNPCs
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000460284.5; ENST00000493706.1
External Link	RMBase: m6A_site_509823
mod ID: M6ASITE050102		Click to Show/Hide the Full List
mod site	chr2:216127583-216127584:+		[6]
Sequence	GGACAGTTGTGGATGCAAAAACCCTAAAAAAAGAAGATATA
Motif Score	2.185083333
Cell/Tissue List	HeLa; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000460284.5; ENST00000392132.7; ENST00000392133.7; ENST00000493706.1
External Link	RMBase: m6A_site_509824
mod ID: M6ASITE050103		Click to Show/Hide the Full List
mod site	chr2:216127613-216127614:+		[6]
Sequence	AAGAAGATATACAAAAAGAAACAGTTTATTGCTTAAATGAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hNPCs; fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000392132.7; ENST00000460284.5; ENST00000493706.1; ENST00000392133.7
External Link	RMBase: m6A_site_509825
mod ID: M6ASITE050104		Click to Show/Hide the Full List
mod site	chr2:216127643-216127644:+		[6]
Sequence	GCTTAAATGATGATGATGAAACTGAAGTTTTAAAAGAGGAT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; hNPCs; fibroblasts; AML
Seq Type List	m6A-seq; DART-seq; miCLIP
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000460284.5; ENST00000493706.1
External Link	RMBase: m6A_site_509826
mod ID: M6ASITE050105		Click to Show/Hide the Full List
mod site	chr2:216127709-216127710:+		[6]
Sequence	TTTTCACTGTTGCCTAAAAGACATTTTCTTCAACATGATGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; hNPCs; LCLs
Seq Type List	m6A-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000493706.1; ENST00000460284.5
External Link	RMBase: m6A_site_509827
mod ID: M6ASITE050106		Click to Show/Hide the Full List
mod site	chr2:216127814-216127815:+		[6]
Sequence	CAGTTTGAAAGGATAATGAGACCCTAGGTCCTTTAGCTCAT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000493706.1; ENST00000392132.7
External Link	RMBase: m6A_site_509828
mod ID: M6ASITE050107		Click to Show/Hide the Full List
mod site	chr2:216130923-216130924:+		[6]
Sequence	TTCTCTAAAGTGGATGAGGAACAAATGAAATATAAATCGGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7; ENST00000471649.1
External Link	RMBase: m6A_site_509829
mod ID: M6ASITE050108		Click to Show/Hide the Full List
mod site	chr2:216137130-216137131:+		[8]
Sequence	CCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392133.7; ENST00000471649.1; ENST00000460284.5; ENST00000392132.7
External Link	RMBase: m6A_site_509830
mod ID: M6ASITE050109		Click to Show/Hide the Full List
mod site	chr2:216137136-216137137:+		[6]
Sequence	TCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; AML
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000392132.7; ENST00000460284.5; ENST00000471649.1; ENST00000392133.7
External Link	RMBase: m6A_site_509831
mod ID: M6ASITE050110		Click to Show/Hide the Full List
mod site	chr2:216137166-216137167:+		[8]
Sequence	CATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAG
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000471649.1; ENST00000392132.7; ENST00000460284.5
External Link	RMBase: m6A_site_509832
mod ID: M6ASITE050111		Click to Show/Hide the Full List
mod site	chr2:216138122-216138123:+		[6]
Sequence	GCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392132.7; ENST00000471649.1; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509833
mod ID: M6ASITE050112		Click to Show/Hide the Full List
mod site	chr2:216138134-216138135:+		[5]
Sequence	CATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000471649.1; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509834
mod ID: M6ASITE050113		Click to Show/Hide the Full List
mod site	chr2:216138155-216138156:+		[6]
Sequence	CATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T; AML
Seq Type List	m6A-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7; ENST00000471649.1
External Link	RMBase: m6A_site_509835
mod ID: M6ASITE050114		Click to Show/Hide the Full List
mod site	chr2:216141189-216141190:+		[7]
Sequence	GGCTTCTCTGTTTAAGAGGCACAGTTGAATGCTGTTGATGC
Motif Score	2.830589286
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000471649.1; ENST00000460284.5
External Link	RMBase: m6A_site_509836
mod ID: M6ASITE050115		Click to Show/Hide the Full List
mod site	chr2:216141218-216141219:+		[8]
Sequence	TGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAGA
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000460284.5; ENST00000392132.7; ENST00000471649.1; ENST00000392133.7
External Link	RMBase: m6A_site_509837
mod ID: M6ASITE050116		Click to Show/Hide the Full List
mod site	chr2:216141250-216141251:+		[6]
Sequence	TGGCAAAGAAAGATGAGAAGACAGACACCCTTGAAGACTTG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000471649.1; ENST00000392132.7; ENST00000460284.5; ENST00000392133.7
External Link	RMBase: m6A_site_509838
mod ID: M6ASITE050117		Click to Show/Hide the Full List
mod site	chr2:216141254-216141255:+		[5]
Sequence	AAAGAAAGATGAGAAGACAGACACCCTTGAAGACTTGTTTC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000471649.1; ENST00000460284.5
External Link	RMBase: m6A_site_509839
mod ID: M6ASITE050118		Click to Show/Hide the Full List
mod site	chr2:216141266-216141267:+		[6]
Sequence	GAAGACAGACACCCTTGAAGACTTGTTTCCAACCACCAAAA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7; ENST00000471649.1
External Link	RMBase: m6A_site_509840
mod ID: M6ASITE050119		Click to Show/Hide the Full List
mod site	chr2:216148102-216148103:+		[5]
Sequence	TGTCTGCTGCACAGAGCTTTACATCCCCGGGAGCCTCTACC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509841
mod ID: M6ASITE050120		Click to Show/Hide the Full List
mod site	chr2:216148172-216148173:+		[5]
Sequence	TGAATCCTCCCGCTGAGGTGACAACAAAAAGTCAGATTCCT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7
External Link	RMBase: m6A_site_509842
mod ID: M6ASITE050121		Click to Show/Hide the Full List
mod site	chr2:216148175-216148176:+		[5]
Sequence	ATCCTCCCGCTGAGGTGACAACAAAAAGTCAGATTCCTCTC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509843
mod ID: M6ASITE050122		Click to Show/Hide the Full List
mod site	chr2:216148208-216148209:+		[6]
Sequence	TTCCTCTCTCTAAAATAAAGACCCTTTTTCCTCTGATTGAA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000460284.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509844
mod ID: M6ASITE050123		Click to Show/Hide the Full List
mod site	chr2:216148272-216148273:+		[6]
Sequence	TGCTCAGGAAATTTTCCAAGACAAGTAAGTACTTGGTATAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7
External Link	RMBase: m6A_site_509845
mod ID: M6ASITE050124		Click to Show/Hide the Full List
mod site	chr2:216160079-216160080:+		[6]
Sequence	TTTTCTAGCCATGAAGATGGACCTACAGCTAAAAAATTAAA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000460284.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509846
mod ID: M6ASITE050125		Click to Show/Hide the Full List
mod site	chr2:216160083-216160084:+		[7]
Sequence	CTAGCCATGAAGATGGACCTACAGCTAAAAAATTAAAGACT
Motif Score	2.078666667
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509847
mod ID: M6ASITE050126		Click to Show/Hide the Full List
mod site	chr2:216160101-216160102:+		[6]
Sequence	CTACAGCTAAAAAATTAAAGACTGAGCAAGGGGGAGCCCAC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000460284.5
External Link	RMBase: m6A_site_509848
mod ID: M6ASITE050127		Click to Show/Hide the Full List
mod site	chr2:216162003-216162004:+		[6]
Sequence	AAGTGTGAATCCTGCTGAAAACTTCCGTGTTCTAGTGAAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000460284.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509849
mod ID: M6ASITE050128		Click to Show/Hide the Full List
mod site	chr2:216162022-216162023:+		[6]
Sequence	AACTTCCGTGTTCTAGTGAAACAGAAGAAGGCCAGCTTTGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; kidney
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509850
mod ID: M6ASITE050129		Click to Show/Hide the Full List
mod site	chr2:216190245-216190246:+		[5]
Sequence	GAGTAACCAGCTCATAAATCACATCGAACAGTTTTTGGATA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509856
mod ID: M6ASITE050130		Click to Show/Hide the Full List
mod site	chr2:216190252-216190253:+		[6]
Sequence	CAGCTCATAAATCACATCGAACAGTTTTTGGATACTAATGA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000460284.5
External Link	RMBase: m6A_site_509857
mod ID: M6ASITE050131		Click to Show/Hide the Full List
mod site	chr2:216190265-216190266:+		[8]
Sequence	ACATCGAACAGTTTTTGGATACTAATGAAACACCGTATTTT
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000460284.5
External Link	RMBase: m6A_site_509858
mod ID: M6ASITE050132		Click to Show/Hide the Full List
mod site	chr2:216190274-216190275:+		[6]
Sequence	AGTTTTTGGATACTAATGAAACACCGTATTTTATGAAGAGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7
External Link	RMBase: m6A_site_509859
mod ID: M6ASITE050133		Click to Show/Hide the Full List
mod site	chr2:216190299-216190300:+		[6]
Sequence	GTATTTTATGAAGAGCATAGACTGCATCCGAGCCTTCCGGG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000460284.5
External Link	RMBase: m6A_site_509860
mod ID: M6ASITE050134		Click to Show/Hide the Full List
mod site	chr2:216192660-216192661:+		[5]
Sequence	TTCAGAAGAGCAGCGCTTTAACAACTTCCTGAAAGCCCTTC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000460284.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509861
mod ID: M6ASITE050135		Click to Show/Hide the Full List
mod site	chr2:216192700-216192701:+		[6]
Sequence	CAAGAGAAAGTGGAAATTAAACAATTAAATCATTTCTGGGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7
External Link	RMBase: m6A_site_509862
mod ID: M6ASITE050136		Click to Show/Hide the Full List
mod site	chr2:216204040-216204041:+		[6]
Sequence	GTCCACCATGCTTATACAGGACACTACACACTGTCTCGACA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7; ENST00000460284.5; ENST00000485763.1
External Link	RMBase: m6A_site_509863
mod ID: M6ASITE050137		Click to Show/Hide the Full List
mod site	chr2:216204118-216204119:+		[6]
Sequence	CTGGTGATGAGTTAGTATGGACTACTTGAACCTCAAAACTG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000485763.1; ENST00000460284.5
External Link	RMBase: m6A_site_509864
mod ID: M6ASITE050138		Click to Show/Hide the Full List
mod site	chr2:216204127-216204128:+		[6]
Sequence	AGTTAGTATGGACTACTTGAACCTCAAAACTGGGCCTCTCA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000392132.7; ENST00000485763.1
External Link	RMBase: m6A_site_509865
mod ID: M6ASITE050139		Click to Show/Hide the Full List
mod site	chr2:216204135-216204136:+		[6]
Sequence	TGGACTACTTGAACCTCAAAACTGGGCCTCTCACCCAAAGC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000485763.1; ENST00000460284.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509866
mod ID: M6ASITE050140		Click to Show/Hide the Full List
mod site	chr2:216204337-216204338:+		[8]
Sequence	ACAGTTTCTGGCCCCCAAAGACAAACCAAGTGGAGACACAG
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392132.7; ENST00000460284.5; ENST00000485763.1; ENST00000392133.7
External Link	RMBase: m6A_site_509867
mod ID: M6ASITE050141		Click to Show/Hide the Full List
mod site	chr2:216204352-216204353:+		[5]
Sequence	CAAAGACAAACCAAGTGGAGACACAGCAGCTGTATTTGAAG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000460284.5; ENST00000392132.7; ENST00000485763.1; ENST00000392133.7
External Link	RMBase: m6A_site_509868
mod ID: M6ASITE050142		Click to Show/Hide the Full List
mod site	chr2:216204388-216204389:+		[8]
Sequence	TGAAGAAGGTGGTGATGTGGACGATTTAGTAAGTACTTTTA
Motif Score	3.616982143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000485763.1; ENST00000392132.7
External Link	RMBase: m6A_site_509869
mod ID: M6ASITE050143		Click to Show/Hide the Full List
mod site	chr2:216205191-216205192:+		[5]
Sequence	TTGTTCTTGTTCACAGTTGGACATGATATAGGTCGTGGATG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000460284.5; ENST00000392132.7; ENST00000392133.7; ENST00000485763.1
External Link	RMBase: m6A_site_509870
mod ID: M6ASITE050144		Click to Show/Hide the Full List
mod site	chr2:216205260-216205261:+		[5]
Sequence	CTGTGATGCTGGGAGTTCTAACAAAACAAGTTGGATGCGGC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000460284.5; ENST00000392133.7; ENST00000392132.7; ENST00000485763.1
External Link	RMBase: m6A_site_509871
mod ID: M6ASITE050145		Click to Show/Hide the Full List
mod site	chr2:216205265-216205266:+		[8]
Sequence	ATGCTGGGAGTTCTAACAAAACAAGTTGGATGCGGCCATTC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000485763.1; ENST00000392132.7; ENST00000392133.7; ENST00000460284.5
External Link	RMBase: m6A_site_509872
mod ID: M6ASITE050146		Click to Show/Hide the Full List
mod site	chr2:216205361-216205362:+		[5]
Sequence	TAATTCTCTGTGGAATGAATACACACATATATATTACAAGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000460284.5; ENST00000485763.1; ENST00000392132.7
External Link	RMBase: m6A_site_509873
mod ID: M6ASITE050147		Click to Show/Hide the Full List
mod site	chr2:216205399-216205400:+		[5]
Sequence	AGGGATAATTTAGACCCCATACAAGTTTATAAAGAGTCATT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7; ENST00000485763.1; ENST00000460284.5
External Link	RMBase: m6A_site_509874
mod ID: M6ASITE050148		Click to Show/Hide the Full List
mod site	chr2:216205459-216205460:+		[8]
Sequence	ATTATTTTTTCTGTGGTCTTACTGATCTTTGTATATTACAT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509875
mod ID: M6ASITE050149		Click to Show/Hide the Full List
mod site	chr2:216205476-216205477:+		[5]
Sequence	CTTACTGATCTTTGTATATTACATACATGCTTTGAAGTTTC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509876
mod ID: M6ASITE050150		Click to Show/Hide the Full List
mod site	chr2:216205480-216205481:+		[5]
Sequence	CTGATCTTTGTATATTACATACATGCTTTGAAGTTTCTGGA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509877
mod ID: M6ASITE050151		Click to Show/Hide the Full List
mod site	chr2:216205518-216205519:+		[8]
Sequence	GGAAAGTAGATCTTTTCTTGACCTAGTATATCAGTGACAGT
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509878
mod ID: M6ASITE050152		Click to Show/Hide the Full List
mod site	chr2:216205534-216205535:+		[7]
Sequence	CTTGACCTAGTATATCAGTGACAGTTGCAGCCCTTGTGATG
Motif Score	2.859755952
Cell/Tissue List	HEK293; liver; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509879
mod ID: M6ASITE050153		Click to Show/Hide the Full List
mod site	chr2:216205575-216205576:+		[6]
Sequence	TGATTAGTGTCTCATGTGGAACCATGGCATGGTTATTGATG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509880
mod ID: M6ASITE050154		Click to Show/Hide the Full List
mod site	chr2:216205640-216205641:+		[7]
Sequence	CTCCTTTGCCTGATCCTCCAACAGCTGTCACAACTTGTGTT
Motif Score	2.173910714
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509881
mod ID: M6ASITE050155		Click to Show/Hide the Full List
mod site	chr2:216205649-216205650:+		[8]
Sequence	CTGATCCTCCAACAGCTGTCACAACTTGTGTTGAGCAAGCA
Motif Score	2.047297619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509882
mod ID: M6ASITE050156		Click to Show/Hide the Full List
mod site	chr2:216205690-216205691:+		[5]
Sequence	GTAGCATTTGCTTCCTCCCAACAAGCAGCTGGGTTAGGAAA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509883
mod ID: M6ASITE050157		Click to Show/Hide the Full List
mod site	chr2:216205765-216205766:+		[5]
Sequence	GTTGAGGCCTTCTAGTTACCACATTACTCTGCCTCTGTATA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509884
mod ID: M6ASITE050158		Click to Show/Hide the Full List
mod site	chr2:216205770-216205771:+		[8]
Sequence	GGCCTTCTAGTTACCACATTACTCTGCCTCTGTATATAGGT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509885
mod ID: M6ASITE050159		Click to Show/Hide the Full List
mod site	chr2:216205822-216205823:+		[7]
Sequence	AGTGGGGTGGGAAGGGGAGCACAATTTCCCTTCATACTCCT
Motif Score	2.830589286
Cell/Tissue List	brain; HEK293T; hESC-HEK293T
Seq Type List	m6A-REF-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509886
mod ID: M6ASITE050160		Click to Show/Hide the Full List
mod site	chr2:216205883-216205884:+		[6]
Sequence	GGTGGTCTCATGAAGAAAAGACCTTTTGGCCCAATCTCTGC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509887
mod ID: M6ASITE050161		Click to Show/Hide the Full List
mod site	chr2:216205915-216205916:+		[6]
Sequence	AATCTCTGCCATATCAGTGAACCTTTAGAAACTCAAAAACT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509888
mod ID: M6ASITE050162		Click to Show/Hide the Full List
mod site	chr2:216205925-216205926:+		[6]
Sequence	ATATCAGTGAACCTTTAGAAACTCAAAAACTGAGAAATTTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509889
mod ID: M6ASITE050163		Click to Show/Hide the Full List
mod site	chr2:216205933-216205934:+		[6]
Sequence	GAACCTTTAGAAACTCAAAAACTGAGAAATTTACTACAGTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509890
mod ID: M6ASITE050164		Click to Show/Hide the Full List
mod site	chr2:216205945-216205946:+		[8]
Sequence	ACTCAAAAACTGAGAAATTTACTACAGTAGTTAGAATTATA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509891
mod ID: M6ASITE050165		Click to Show/Hide the Full List
mod site	chr2:216205948-216205949:+		[7]
Sequence	CAAAAACTGAGAAATTTACTACAGTAGTTAGAATTATATCA
Motif Score	2.078666667
Cell/Tissue List	kidney; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509892
mod ID: M6ASITE050166		Click to Show/Hide the Full List
mod site	chr2:216205973-216205974:+		[8]
Sequence	AGTTAGAATTATATCACTTCACTGTTCTCTACTTGCAAGCC
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509893
mod ID: M6ASITE050167		Click to Show/Hide the Full List
mod site	chr2:216205983-216205984:+		[8]
Sequence	ATATCACTTCACTGTTCTCTACTTGCAAGCCTCAAAGAGAG
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509894
mod ID: M6ASITE050168		Click to Show/Hide the Full List
mod site	chr2:216206023-216206024:+		[6]
Sequence	GAAAGTTTCGTTATATTAAAACACTTAGGTAACTTTTCGGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000392133.7; ENST00000392132.7
External Link	RMBase: m6A_site_509895
mod ID: M6ASITE050169		Click to Show/Hide the Full List
mod site	chr2:216206097-216206098:+		[8]
Sequence	TTGTGGATGGTGTCTCCTTTACTAAATAAGAAAATAACAAA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509896
mod ID: M6ASITE050170		Click to Show/Hide the Full List
mod site	chr2:216206113-216206114:+		[8]
Sequence	CTTTACTAAATAAGAAAATAACAAAGCCCTTATTCTCTTTT
Motif Score	2.168095238
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509897
mod ID: M6ASITE050171		Click to Show/Hide the Full List
mod site	chr2:216206184-216206185:+		[6]
Sequence	AGTTCCTCTTTGGTGTACAGACTTCTTGGTACCCAGTCACC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509898
mod ID: M6ASITE050172		Click to Show/Hide the Full List
mod site	chr2:216206239-216206240:+		[5]
Sequence	CCTCATAAGTCGTCACTAATACACAGTTTTGTACATGTAAC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392132.7; ENST00000392133.7
External Link	RMBase: m6A_site_509899

N7-methylguanosine (m7G)

In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000075		Click to Show/Hide the Full List
mod site	chr2:216109376-216109377:+		[9]
Sequence	CGCTTGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCC
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000476360.1; ENST00000429133.5; ENST00000392133.7; ENST00000417391.1; ENST00000392132.7
External Link	RMBase: m7G_site_547

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000244		Click to Show/Hide the Full List
mod site	chr2:216141220-216141221:+		[10]
Sequence	CTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAGAAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000471649.1; ENST00000460284.5; ENST00000392133.7; ENST00000392132.7
External Link	RMBase: Nm_site_3337

Ref 1	Two concurrent phase II trials of paclitaxel/carboplatin/trastuzumab (weekly or every-3-week schedule) as first-line therapy in women with HER2-overexpressing metastatic breast cancer: NCCTG study 983252. Clin Breast Cancer. 2005 Dec;6(5):425-32. doi: 10.3816/CBC.2005.n.047.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 4	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 9	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.
Ref 10	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map