m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00736)

Target Name	Signal transducer and activator of transcription 5A (STAT5A)
Gene Name	STAT5A
Chromosomal Location	17q21.2
Family	Transcription factor STAT family
Function	Carries out a dual function: signal transduction and activation of transcription. Mediates cellular responses to the cytokine KITLG/SCF and other growth factors. Mediates cellular responses to ERBB4. May mediate cellular responses to activated FGFR1, FGFR2, FGFR3 and FGFR4. Binds to the GAS element and activates PRL-induced transcription. Regulates the expression of milk proteins during lactation. Click to Show/Hide
Gene ID	6776
Uniprot ID	STA5A_HUMAN
HGNC ID	HGNC:11366
KEGG ID	hsa:6776

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

STAT5A can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	The analyses of m6A-RIP-seq and RIP-PCR indicated that Signal transducer and activator of transcription 5A (STAT5A) was the downstream target of YTHDF2, which was binding to the m6A modification site of STAT5A to promote its mRNA degradation. ChIP-seq and PCR assays revealed that STAT5A suppressed multiple myelomacell proliferation by occupying the transcription site of MAP2K2 to decrease ERK phosphorylation.
Target Regulation	Down regulation
Responsed Disease	Multiple myeloma	ICD-11: 2A83.1	Disease Info
Pathway Response	MAPK signaling pathway		hsa04010

Multiple myeloma [ICD-11: 2A83]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	The analyses of m6A-RIP-seq and RIP-PCR indicated that Signal transducer and activator of transcription 5A (STAT5A) was the downstream target of YTHDF2, which was binding to the m6A modification site of STAT5A to promote its mRNA degradation. ChIP-seq and PCR assays revealed that STAT5A suppressed multiple myelomacell proliferation by occupying the transcription site of MAP2K2 to decrease ERK phosphorylation.
Responsed Disease	Multiple myeloma [ICD-11: 2A83.1]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)	READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	MAPK signaling pathway		hsa04010

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00736)

Signal transducer and activator of transcription 5A (STAT5A)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE008005		Click to Show/Hide the Full List
mod site	chr17:42291131-42291132:+		[3]
Sequence	GTGACAGATCACCAGGCATTAGATTCTCTTAAGAAGTGCAT
Transcript ID List	ENST00000588868.5; ENST00000444283.5; ENST00000590949.5; ENST00000345506.8; ENST00000590726.6; ENST00000546010.6; ENST00000478897.1
External Link	RMBase: RNA-editing_site_57550
mod ID: A2ISITE008006		Click to Show/Hide the Full List
mod site	chr17:42301617-42301618:+		[4]
Sequence	TTCCCACCTCAGCCTCCCAAAGTGCTGAGTTGATAGGCGTG
Transcript ID List	ENST00000590949.5; ENST00000588868.5; ENST00000546010.6; ENST00000345506.8
External Link	RMBase: RNA-editing_site_57551

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001128		Click to Show/Hide the Full List
mod site	chr17:42308257-42308258:+		[5]
Sequence	TGGCTGACCGGCTGGGGGACCTGAGCTATCTCATCTATGTG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000546010.6; ENST00000345506.8; ENST00000468096.5; ENST00000587646.1; ENST00000590949.5; ENST00000588868.5; ENST00000591556.1
External Link	RMBase: m5C_site_18935

N6-methyladenosine (m6A)

In total 54 m6A sequence/site(s) in this target gene
mod ID: M6ASITE032673		Click to Show/Hide the Full List
mod site	chr17:42287548-42287549:+		[6]
Sequence	GAGGGGGACTGAGGCTCTAGACAGGATATTCACTGCTGTGG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8
External Link	RMBase: m6A_site_363455
mod ID: M6ASITE032674		Click to Show/Hide the Full List
mod site	chr17:42287601-42287602:+		[6]
Sequence	AGAGTTTCGAAGTTAGGAGGACTCAAGACGGTCCCTCCCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000345506.8
External Link	RMBase: m6A_site_363456
mod ID: M6ASITE032675		Click to Show/Hide the Full List
mod site	chr17:42287623-42287624:+		[6]
Sequence	TCAAGACGGTCCCTCCCTGGACTTTTCTGAAGGTAGAACCA
Motif Score	4.065041667
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000345506.8
External Link	RMBase: m6A_site_363457
mod ID: M6ASITE032676		Click to Show/Hide the Full List
mod site	chr17:42288139-42288140:+		[7]
Sequence	CCCTTTTTGCGGATGAGAAAACTGAGGCCCAGGTTTGGGAT
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000345506.8; ENST00000546010.6; ENST00000590949.5
External Link	RMBase: m6A_site_363458
mod ID: M6ASITE032677		Click to Show/Hide the Full List
mod site	chr17:42288272-42288273:+		[7]
Sequence	GCCGCCGAGGGCCTGCTGGGACTCCCGGGGGACCCCGCCGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000590949.5; ENST00000345506.8
External Link	RMBase: m6A_site_363459
mod ID: M6ASITE032678		Click to Show/Hide the Full List
mod site	chr17:42288283-42288284:+		[7]
Sequence	CCTGCTGGGACTCCCGGGGGACCCCGCCGTCGGGGCAGCCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000590949.5; ENST00000546010.6; ENST00000345506.8
External Link	RMBase: m6A_site_363460
mod ID: M6ASITE032679		Click to Show/Hide the Full List
mod site	chr17:42288529-42288530:+		[8]
Sequence	CGCTGCCGCCGCCGCCAGGAACCCCGGCCGGGAGCGAGAGC
Motif Score	2.930744048
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000590726.6; ENST00000345506.8; ENST00000444283.5; ENST00000469124.1; ENST00000590949.5
External Link	RMBase: m6A_site_363461
mod ID: M6ASITE032680		Click to Show/Hide the Full List
mod site	chr17:42289882-42289883:+		[7]
Sequence	AAGGGATGCCATTGACTTGGACAATCCCCAGGACAGAGCCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000590949.5; ENST00000588868.5; ENST00000444283.5; ENST00000590726.6; ENST00000345506.8; ENST00000478897.1; ENST00000469124.1; ENST00000546010.6
External Link	RMBase: m6A_site_363462
mod ID: M6ASITE032681		Click to Show/Hide the Full List
mod site	chr17:42289894-42289895:+		[9]
Sequence	TGACTTGGACAATCCCCAGGACAGAGCCCAAGCCACCCAGC
Motif Score	3.643047619
Cell/Tissue List	MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000478897.1; ENST00000444283.5; ENST00000588868.5; ENST00000590949.5; ENST00000546010.6; ENST00000345506.8; ENST00000469124.1; ENST00000590726.6
External Link	RMBase: m6A_site_363463
mod ID: M6ASITE032682		Click to Show/Hide the Full List
mod site	chr17:42292033-42292034:+		[10]
Sequence	CGGCACATTCTGTACAATGAACAGAGGCTGGTCCGAGAAGC
Motif Score	2.951386905
Cell/Tissue List	NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000590726.6; ENST00000345506.8; ENST00000546010.6; ENST00000588868.5; ENST00000444283.5; ENST00000478897.1; ENST00000590949.5
External Link	RMBase: m6A_site_363464
mod ID: M6ASITE032683		Click to Show/Hide the Full List
mod site	chr17:42295681-42295682:+		[7]
Sequence	AGCACCTTCAGATCAACCAGACATTTGAGGAGCTGCGACTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD4T; endometrial; NB4; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000590949.5; ENST00000345506.8; ENST00000546010.6; ENST00000588868.5; ENST00000590726.6
External Link	RMBase: m6A_site_363465
mod ID: M6ASITE032684		Click to Show/Hide the Full List
mod site	chr17:42295712-42295713:+		[7]
Sequence	GCTGCGACTGGTCACGCAGGACACAGAGAATGAGCTGAAGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD4T; endometrial; NB4; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000546010.6; ENST00000588868.5; ENST00000345506.8; ENST00000590949.5; ENST00000590726.6
External Link	RMBase: m6A_site_363466
mod ID: M6ASITE032685		Click to Show/Hide the Full List
mod site	chr17:42295734-42295735:+		[7]
Sequence	ACAGAGAATGAGCTGAAGAAACTGCAGCAGACTCAGGAGTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD4T; peripheral-blood; endometrial; NB4; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000590726.6; ENST00000590949.5; ENST00000546010.6; ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363467
mod ID: M6ASITE032686		Click to Show/Hide the Full List
mod site	chr17:42295744-42295745:+		[7]
Sequence	AGCTGAAGAAACTGCAGCAGACTCAGGAGTACTTCATCATC
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD4T; peripheral-blood; endometrial; NB4; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000590726.6; ENST00000546010.6; ENST00000588868.5; ENST00000590949.5
External Link	RMBase: m6A_site_363468
mod ID: M6ASITE032687		Click to Show/Hide the Full List
mod site	chr17:42299860-42299861:+		[7]
Sequence	GGTTGCAGCGTGAGGCACAGACACTGCAGCAGTACCGCGTG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000590726.6; ENST00000588868.5; ENST00000590949.5; ENST00000546010.6; ENST00000345506.8
External Link	RMBase: m6A_site_363469
mod ID: M6ASITE032688		Click to Show/Hide the Full List
mod site	chr17:42300153-42300154:+		[7]
Sequence	TGGCCGAGAAGCACCAGAAGACCCTGCAGCTGCTGCGGAAG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000590949.5; ENST00000546010.6; ENST00000588868.5; ENST00000345506.8; ENST00000590726.6
External Link	RMBase: m6A_site_363470
mod ID: M6ASITE032689		Click to Show/Hide the Full List
mod site	chr17:42300746-42300747:+		[7]
Sequence	GGCCGAGATCATCTGGCAGAACCGGCAGCAGATCCGCAGGG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546010.6; ENST00000345506.8; ENST00000590949.5; ENST00000588868.5
External Link	RMBase: m6A_site_363471
mod ID: M6ASITE032690		Click to Show/Hide the Full List
mod site	chr17:42300845-42300846:+		[7]
Sequence	GGTCAACGCCACCATCACGGACATTATCTCAGCCCTGGTGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000345506.8; ENST00000588868.5; ENST00000590949.5
External Link	RMBase: m6A_site_363472
mod ID: M6ASITE032691		Click to Show/Hide the Full List
mod site	chr17:42301314-42301315:+		[7]
Sequence	AGCCTCCTCAGGTCCTGAAGACCCAGACCAAGTTTGCAGCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000590949.5; ENST00000546010.6; ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363473
mod ID: M6ASITE032692		Click to Show/Hide the Full List
mod site	chr17:42301320-42301321:+		[7]
Sequence	CTCAGGTCCTGAAGACCCAGACCAAGTTTGCAGCCACCGTA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000590949.5; ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363474
mod ID: M6ASITE032693		Click to Show/Hide the Full List
mod site	chr17:42301444-42301445:+		[8]
Sequence	GTCTCTGCTTAAAAATGAGAACACCCGCAAGTAATTGTGCC
Motif Score	2.951386905
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000345506.8; ENST00000590949.5; ENST00000546010.6; ENST00000588868.5
External Link	RMBase: m6A_site_363475
mod ID: M6ASITE032694		Click to Show/Hide the Full List
mod site	chr17:42304208-42304209:+		[8]
Sequence	ACCCAGAAAGACGCCAAGAAACACTCTTAGGGGATACGGGG
Motif Score	2.20572619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000588868.5; ENST00000479417.1; ENST00000590949.5; ENST00000345506.8
External Link	RMBase: m6A_site_363476
mod ID: M6ASITE032695		Click to Show/Hide the Full List
mod site	chr17:42304262-42304263:+		[8]
Sequence	CAGGGCTGACCTGAGCGAAGACCCCAGCCCGAGGTGTGGAC
Motif Score	2.876744048
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000479417.1; ENST00000588868.5; ENST00000345506.8; ENST00000546010.6; ENST00000590949.5
External Link	RMBase: m6A_site_363477
mod ID: M6ASITE032696		Click to Show/Hide the Full List
mod site	chr17:42304281-42304282:+		[8]
Sequence	GACCCCAGCCCGAGGTGTGGACAGGACCATGCTCCTGGCCT
Motif Score	3.643047619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000590949.5; ENST00000345506.8; ENST00000479417.1; ENST00000546010.6; ENST00000588868.5
External Link	RMBase: m6A_site_363478
mod ID: M6ASITE032697		Click to Show/Hide the Full List
mod site	chr17:42304286-42304287:+		[8]
Sequence	CAGCCCGAGGTGTGGACAGGACCATGCTCCTGGCCTGGGGC
Motif Score	3.622404762
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000479417.1; ENST00000345506.8; ENST00000546010.6; ENST00000588868.5; ENST00000590949.5
External Link	RMBase: m6A_site_363479
mod ID: M6ASITE032698		Click to Show/Hide the Full List
mod site	chr17:42306301-42306302:+		[11]
Sequence	GCAGCTGTGTGAGGCGCTCAACATGAAATTCAAGGCCGAAG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000468096.5; ENST00000591556.1; ENST00000546010.6; ENST00000479417.1; ENST00000588868.5; ENST00000345506.8; ENST00000590949.5; ENST00000587646.1
External Link	RMBase: m6A_site_363480
mod ID: M6ASITE032699		Click to Show/Hide the Full List
mod site	chr17:42306382-42306383:+		[11]
Sequence	CCTGGCGCAGAAACTGTTCAACAACAGCAGCAGCCACCTGG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000587646.1; ENST00000588868.5; ENST00000546010.6; ENST00000468096.5; ENST00000591556.1; ENST00000590949.5; ENST00000345506.8
External Link	RMBase: m6A_site_363481
mod ID: M6ASITE032700		Click to Show/Hide the Full List
mod site	chr17:42307656-42307657:+		[7]
Sequence	TCATCAACAAGCCCGACGGGACCTTCTTGTTGCGCTTTAGT
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000588868.5; ENST00000345506.8; ENST00000546010.6; ENST00000590949.5; ENST00000591556.1; ENST00000468096.5; ENST00000587646.1
External Link	RMBase: m6A_site_363482
mod ID: M6ASITE032701		Click to Show/Hide the Full List
mod site	chr17:42308195-42308196:+		[7]
Sequence	AGCGGAACGCAACCTGTGGAACCTGAAACCATTCACCACGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000591556.1; ENST00000588868.5; ENST00000345506.8; ENST00000468096.5; ENST00000546010.6; ENST00000587646.1; ENST00000590949.5
External Link	RMBase: m6A_site_363483
mod ID: M6ASITE032702		Click to Show/Hide the Full List
mod site	chr17:42308202-42308203:+		[7]
Sequence	CGCAACCTGTGGAACCTGAAACCATTCACCACGCGGGATTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000588868.5; ENST00000468096.5; ENST00000345506.8; ENST00000546010.6; ENST00000590949.5; ENST00000591556.1; ENST00000587646.1
External Link	RMBase: m6A_site_363484
mod ID: M6ASITE032703		Click to Show/Hide the Full List
mod site	chr17:42308255-42308256:+		[12]
Sequence	CCTGGCTGACCGGCTGGGGGACCTGAGCTATCTCATCTATG
Motif Score	3.622404762
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000546010.6; ENST00000588868.5; ENST00000590949.5; ENST00000345506.8; ENST00000468096.5; ENST00000591556.1; ENST00000587646.1
External Link	RMBase: m6A_site_363485
mod ID: M6ASITE032704		Click to Show/Hide the Full List
mod site	chr17:42309071-42309072:+		[8]
Sequence	GCTGTTGATGGATATGTGAAACCACAGATCAAGCAAGTGGT
Motif Score	2.185083333
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000588868.5; ENST00000345506.8; ENST00000468096.5; ENST00000587646.1; ENST00000590949.5
External Link	RMBase: m6A_site_363486
mod ID: M6ASITE032705		Click to Show/Hide the Full List
mod site	chr17:42309426-42309427:+		[8]
Sequence	CAGCAGCGCCACGTACATGGACCAGGCCCCCTCCCCAGCTG
Motif Score	3.622404762
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5; ENST00000587646.1; ENST00000590949.5; ENST00000546010.6; ENST00000468096.5
External Link	RMBase: m6A_site_363487
mod ID: M6ASITE032706		Click to Show/Hide the Full List
mod site	chr17:42309519-42309520:+		[8]
Sequence	ATGGGGTCCGCAGGGGAAGAACTGGGGACTTGGCCCCAGGC
Motif Score	3.373380952
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000590949.5; ENST00000546010.6; ENST00000345506.8; ENST00000588868.5; ENST00000587646.1; ENST00000468096.5
External Link	RMBase: m6A_site_363488
mod ID: M6ASITE032707		Click to Show/Hide the Full List
mod site	chr17:42309526-42309527:+		[8]
Sequence	CCGCAGGGGAAGAACTGGGGACTTGGCCCCAGGCTGGACTC
Motif Score	4.065041667
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000588868.5; ENST00000345506.8; ENST00000468096.5; ENST00000587646.1; ENST00000546010.6; ENST00000590949.5
External Link	RMBase: m6A_site_363489
mod ID: M6ASITE032708		Click to Show/Hide the Full List
mod site	chr17:42309622-42309623:+		[7]
Sequence	GAGTGAGATCAGCCAGGAAAACAGAGCATTTTGAAGCTAGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546010.6; rmsk_4694655; ENST00000590949.5; ENST00000588868.5; ENST00000587646.1; ENST00000345506.8; ENST00000468096.5
External Link	RMBase: m6A_site_363490
mod ID: M6ASITE032709		Click to Show/Hide the Full List
mod site	chr17:42309642-42309643:+		[7]
Sequence	ACAGAGCATTTTGAAGCTAGACATAGCAGGGTCAAGTCCTC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546010.6; ENST00000588868.5; ENST00000468096.5; rmsk_4694655; ENST00000590949.5; ENST00000345506.8; ENST00000587646.1
External Link	RMBase: m6A_site_363491
mod ID: M6ASITE032710		Click to Show/Hide the Full List
mod site	chr17:42310552-42310553:+		[7]
Sequence	GAGAATTCGACCTGGATGAGACCATGGATGTGGCCAGGCAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; H1B; MT4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000588868.5; ENST00000345506.8; ENST00000590949.5
External Link	RMBase: m6A_site_363492
mod ID: M6ASITE032711		Click to Show/Hide the Full List
mod site	chr17:42310581-42310582:+		[7]
Sequence	GTGGCCAGGCACGTGGAGGAACTCTTACGCCGACCAATGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; H1B; LCLs; MT4; MM6; Jurkat
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546010.6; ENST00000588868.5; ENST00000345506.8; ENST00000590949.5
External Link	RMBase: m6A_site_363493
mod ID: M6ASITE032712		Click to Show/Hide the Full List
mod site	chr17:42310601-42310602:+		[7]
Sequence	ACTCTTACGCCGACCAATGGACAGTCTTGACTCCCGCCTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; H1B; LCLs; MT4; MM6; Jurkat
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000590949.5; ENST00000345506.8; ENST00000588868.5; ENST00000546010.6
External Link	RMBase: m6A_site_363494
mod ID: M6ASITE032713		Click to Show/Hide the Full List
mod site	chr17:42310698-42310699:+		[7]
Sequence	TCCCACGCTTCTCTTTGGAAACAATATGCAATGTGAAGCGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; LCLs; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000590949.5; ENST00000345506.8; ENST00000588868.5; ENST00000546010.6
External Link	RMBase: m6A_site_363495
mod ID: M6ASITE032714		Click to Show/Hide the Full List
mod site	chr17:42310923-42310924:+		[12]
Sequence	CTGTCTCTGTCATGGTAGAGACCGAGCCTCTGTCACTGCAG
Motif Score	2.876744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000546010.6; ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363496
mod ID: M6ASITE032715		Click to Show/Hide the Full List
mod site	chr17:42310961-42310962:+		[12]
Sequence	CAGGCACTCAATGCAGCCAGACCTATTCCTCCTGGGCCCCT
Motif Score	2.876744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363497
mod ID: M6ASITE032716		Click to Show/Hide the Full List
mod site	chr17:42311031-42311032:+		[7]
Sequence	GATTCAGAAGGGGAGGGGAGACAGGTAACGTCTGTAAGCTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363498
mod ID: M6ASITE032717		Click to Show/Hide the Full List
mod site	chr17:42311098-42311099:+		[7]
Sequence	TGCCCTCCTAAGAGAGAGAGACAGAGAGACAGAGAGAGAGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000588868.5; ENST00000345506.8; rmsk_4694660
External Link	RMBase: m6A_site_363499
mod ID: M6ASITE032718		Click to Show/Hide the Full List
mod site	chr17:42311106-42311107:+		[7]
Sequence	TAAGAGAGAGAGACAGAGAGACAGAGAGAGAGAAAGAGAGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	rmsk_4694660; ENST00000588868.5; ENST00000345506.8
External Link	RMBase: m6A_site_363500
mod ID: M6ASITE032719		Click to Show/Hide the Full List
mod site	chr17:42311527-42311528:+		[7]
Sequence	GTCTAGGATATGGTGGGTGGACAGGGGCCCCGGGACTTGGA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363501
mod ID: M6ASITE032720		Click to Show/Hide the Full List
mod site	chr17:42311541-42311542:+		[7]
Sequence	GGGTGGACAGGGGCCCCGGGACTTGGAGGGTTGGTCCTCTT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363502
mod ID: M6ASITE032721		Click to Show/Hide the Full List
mod site	chr17:42311576-42311577:+		[7]
Sequence	CCTCTTGCCTCCTGGAAAAAACAAAAACAAAAAACTGCAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000588868.5; ENST00000345506.8
External Link	RMBase: m6A_site_363503
mod ID: M6ASITE032722		Click to Show/Hide the Full List
mod site	chr17:42311582-42311583:+		[7]
Sequence	GCCTCCTGGAAAAAACAAAAACAAAAAACTGCAGTGAAAGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363504
mod ID: M6ASITE032723		Click to Show/Hide the Full List
mod site	chr17:42311589-42311590:+		[7]
Sequence	GGAAAAAACAAAAACAAAAAACTGCAGTGAAAGACAAGCTG
Motif Score	2.627720238
Cell/Tissue List	HeLa; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363505
mod ID: M6ASITE032724		Click to Show/Hide the Full List
mod site	chr17:42311602-42311603:+		[7]
Sequence	ACAAAAAACTGCAGTGAAAGACAAGCTGCAAATCAGCCATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000345506.8; ENST00000588868.5
External Link	RMBase: m6A_site_363506
mod ID: M6ASITE032725		Click to Show/Hide the Full List
mod site	chr17:42311784-42311785:+		[7]
Sequence	CCTCCCTCTGAGGCTGTAGGACTCGCAGTCAGGGGCAGCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; Jurkat; peripheral-blood; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000588868.5; ENST00000345506.8
External Link	RMBase: m6A_site_363507
mod ID: M6ASITE032726		Click to Show/Hide the Full List
mod site	chr17:42311835-42311836:+		[7]
Sequence	ATTGAGAGCCCAAGGTTTAAACTTCTCTGAAGGGAGGTGGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; Jurkat; peripheral-blood; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000588868.5; ENST00000345506.8
External Link	RMBase: m6A_site_363508

Ref 1	Exposure and response analysis of aleglitazar on cardiovascular risk markers and safety outcomes: An analysis of the AleCardio trial. Diabetes Obes Metab. 2020 Jan;22(1):30-38. doi: 10.1111/dom.13862. Epub 2019 Oct 1.
Ref 2	YTHDF2 promotes multiple myeloma cell proliferation via STAT5A/MAP2K2/p-ERK axis. Oncogene. 2022 Mar;41(10):1482-1491. doi: 10.1038/s41388-022-02191-3. Epub 2022 Jan 24.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 5	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 6	RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun. 2019 May 6;10(1):2065. doi: 10.1038/s41467-019-09865-9.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 9	FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase. Cancer Cell. 2017 Jan 9;31(1):127-141. doi: 10.1016/j.ccell.2016.11.017. Epub 2016 Dec 22.
Ref 10	METTL14 Inhibits Hematopoietic Stem/Progenitor Differentiation and Promotes Leukemogenesis via mRNA m(6)A Modification. Cell Stem Cell. 2018 Feb 1;22(2):191-205.e9. doi: 10.1016/j.stem.2017.11.016. Epub 2017 Dec 28.
Ref 11	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 12	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map