m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00727)

Target Name	Gap junction alpha-1 protein (GJA1)
Synonyms	Connexin-43; Cx43; Gap junction 43 kDa heart protein Click to Show/Hide
Gene Name	GJA1
Chromosomal Location	6q22.31
Family	Connexin family, Alpha-type (group II) subfamily
Function	Gap junction protein that acts as a regulator of bladder capacity. A gap junction consists of a cluster of closely packed pairs of transmembrane channels, the connexons, through which materials of low MW diffuse from one cell to a neighboring cell. May play a critical role in the physiology of hearing by participating in the recycling of potassium to the cochlear endolymph. Negative regulator of bladder functional capacity: acts by enhancing intercellular electrical and chemical transmission, thus sensitizing bladder muscles to cholinergic neural stimuli and causing them to contract (By similarity). May play a role in cell growth inhibition through the regulation of NOV expression and localization. Plays an essential role in gap junction communication in the ventricles (By similarity). Click to Show/Hide
Gene ID	2697
Uniprot ID	CXA1_HUMAN
HGNC ID	HGNC:4274
KEGG ID	hsa:2697

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

GJA1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF3*
Cell Line	Mouse embryonic fibroblasts	Mus musculus
Treatment: shYthdf3 embryonic fibroblasts Control: shLuc embryonic fibroblasts		GSE156437
Regulation		logFC: -7.79E-01 p-value: 7.79E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Mechanistically, YTHDF3 enhances the translation of m6A-enriched transcripts for ST6GALNAC5, Gap junction alpha-1 protein (GJA1), and EGFR, all associated with breast cancer brain metastasis. This work uncovers an essential role of YTHDF3 in controlling the interaction between cancer cells and brain microenvironment, thereby inducing brain metastatic competence.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Cell metastasis
In-vitro Model	MDA-MB-231Br (After brain metastases of MDA-MB-361 breast adenocarcinoma cells)
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-IBC-3	Breast inflammatory carcinoma	Homo sapiens	CVCL_HC47
	JIMT-1Br3 (After brain metastases of JIMT-1 breast cancer cells)
	JIMT-1	Breast ductal carcinoma	Homo sapiens	CVCL_2077
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
	HCC1954Br (After brain metastases of HCC1954 breast cancer cells)
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	bEnd.3	Cerebrovascular endothelioma cells from mice	Mus musculus	CVCL_0170
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	4T1Br (After brain metastases of 4T1 mouse breast cancer cells)
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For the in vivo brain and bone extravasation and seeding assays, cancer cells labeled with CMFDA C2925 (Thermo fisher scientific) or GFP were injected intracardially into the nude mice. Cell number and injection procedure were described in "Animal Experiments". For the in vivo lung extravasation and seeding assays, cancer cells labeled with GFP (2.5 × 10⁵ cells/mouse) were injected into the tail vein of nude mice. At 24 or 48 hrs later, the mice were sacrificed.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Mechanistically, YTHDF3 enhances the translation of m6A-enriched transcripts for ST6GALNAC5, Gap junction alpha-1 protein (GJA1), and EGFR, all associated with breast cancer brain metastasis. This work uncovers an essential role of YTHDF3 in controlling the interaction between cancer cells and brain microenvironment, thereby inducing brain metastatic competence.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell metastasis
In-vitro Model	MDA-MB-231Br (After brain metastases of MDA-MB-361 breast adenocarcinoma cells)
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-IBC-3	Breast inflammatory carcinoma	Homo sapiens	CVCL_HC47
	JIMT-1Br3 (After brain metastases of JIMT-1 breast cancer cells)
	JIMT-1	Breast ductal carcinoma	Homo sapiens	CVCL_2077
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
	HCC1954Br (After brain metastases of HCC1954 breast cancer cells)
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	bEnd.3	Cerebrovascular endothelioma cells from mice	Mus musculus	CVCL_0170
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	4T1Br (After brain metastases of 4T1 mouse breast cancer cells)
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For the in vivo brain and bone extravasation and seeding assays, cancer cells labeled with CMFDA C2925 (Thermo fisher scientific) or GFP were injected intracardially into the nude mice. Cell number and injection procedure were described in "Animal Experiments". For the in vivo lung extravasation and seeding assays, cancer cells labeled with GFP (2.5 × 10⁵ cells/mouse) were injected into the tail vein of nude mice. At 24 or 48 hrs later, the mice were sacrificed.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00727)

Gap junction alpha-1 protein (GJA1)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000112		Click to Show/Hide the Full List
mod site	chr6:121448083-121448084:+		[2]
Sequence	ACCAGGTGTTAATTTTGATCCGGTGGAGGTGGTACTCAACA
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000647564.1; ENST00000650427.1; ENST00000649132.1; ENST00000649003.1; ENST00000282561.4
External Link	RMBase: ac4C_site_1617

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000413		Click to Show/Hide the Full List
mod site	chr6:121443632-121443633:+		[3]
Sequence	AATAAAGACTATACTTTCAGGGATCATTTCTATAGTTTGTT
Cell/Tissue List	HEK293
Seq Type List	RiboMeth-seq
Transcript ID List	ENST00000282561.4; ENST00000649132.1; ENST00000650427.1; ENST00000647564.1; ENST00000649003.1; rmsk_2058536
External Link	RMBase: Nm_site_5969

Other RNA modification (m2,2,7Gpp(pN))

In total 1 m6A sequence/site(s) in this target gene
mod ID: RNASITE000001		Click to Show/Hide the Full List
mod site	chr6:121443615-121443616:+		[4]
Sequence	TTTTTTTATAGAATGTAAATAAAGACTATACTTTCAGGGAT
Cell/Tissue List	nucleoplasmic
Transcript ID List	ENST00000282561.4; ENST00000650427.1; ENST00000647564.1; ENST00000649003.1; ENST00000649132.1
External Link	RMBase: otherMod_site_1067

N6-methyladenosine (m6A)

In total 65 m6A sequence/site(s) in this target gene
mod ID: M6ASITE076896		Click to Show/Hide the Full List
mod site	chr6:121435614-121435615:+		[5]
Sequence	AGTTGAGTCAGTGGCTTGAAACTTTTAAAAGCTCTGTGCTC
Motif Score	2.627720238
Cell/Tissue List	fibroblasts; A549; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649132.1; ENST00000649003.1
External Link	RMBase: m6A_site_732519
mod ID: M6ASITE076897		Click to Show/Hide the Full List
mod site	chr6:121435709-121435710:+		[5]
Sequence	AGGCGTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACT
Motif Score	2.20572619
Cell/Tissue List	fibroblasts; A549; Huh7; HEK293A-TOA; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649132.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732520
mod ID: M6ASITE076898		Click to Show/Hide the Full List
mod site	chr6:121435727-121435728:+		[5]
Sequence	AAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGA
Motif Score	2.627720238
Cell/Tissue List	fibroblasts; A549; Huh7; HEK293A-TOA; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649132.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732521
mod ID: M6ASITE076899		Click to Show/Hide the Full List
mod site	chr6:121435738-121435739:+		[6]
Sequence	GAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAACT
Motif Score	2.897386905
Cell/Tissue List	A549; fibroblasts; Huh7; HEK293A-TOA; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000282561.4; ENST00000649132.1
External Link	RMBase: m6A_site_732522
mod ID: M6ASITE076900		Click to Show/Hide the Full List
mod site	chr6:121435756-121435757:+		[6]
Sequence	AGACAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTT
Motif Score	3.373380952
Cell/Tissue List	A549; fibroblasts; Huh7; HEK293A-TOA; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000282561.4; ENST00000649132.1; ENST00000649003.1
External Link	RMBase: m6A_site_732523
mod ID: M6ASITE076901		Click to Show/Hide the Full List
mod site	chr6:121437386-121437387:+		[6]
Sequence	TTTTTCTTTTTTCCTCTTAAACTTGCTGAATCCCACTATCT
Motif Score	2.627720238
Cell/Tissue List	A549; Huh7; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000649003.1; ENST00000282561.4; ENST00000649132.1; ENST00000650427.1
External Link	RMBase: m6A_site_732524
mod ID: M6ASITE076902		Click to Show/Hide the Full List
mod site	chr6:121446845-121446846:+		[7]
Sequence	TTTCAGGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCT
Motif Score	2.173910714
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000649132.1; ENST00000647564.1; ENST00000650427.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732525
mod ID: M6ASITE076903		Click to Show/Hide the Full List
mod site	chr6:121446873-121446874:+		[8]
Sequence	GACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGC
Motif Score	2.627720238
Cell/Tissue List	HEK293T; H1A; HEK293A-TOA; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000282561.4; ENST00000649003.1; ENST00000649132.1; ENST00000650427.1; ENST00000647564.1
External Link	RMBase: m6A_site_732526
mod ID: M6ASITE076904		Click to Show/Hide the Full List
mod site	chr6:121446881-121446882:+		[7]
Sequence	CGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAA
Motif Score	2.859755952
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000647564.1; ENST00000282561.4; ENST00000649003.1; ENST00000649132.1; ENST00000650427.1
External Link	RMBase: m6A_site_732527
mod ID: M6ASITE076905		Click to Show/Hide the Full List
mod site	chr6:121446961-121446962:+		[7]
Sequence	TCCGAATCCTGCTGCTGGGGACAGCGGTTGAGTCAGCCTGG
Motif Score	3.643047619
Cell/Tissue List	HEK293T; kidney; H1A; H1B; A549; HEK293A-TOA; endometrial
Seq Type List	MeRIP-seq; m6A-REF-seq; m6A-seq
Transcript ID List	ENST00000647564.1; ENST00000649132.1; ENST00000282561.4; ENST00000650427.1; ENST00000649003.1
External Link	RMBase: m6A_site_732528
mod ID: M6ASITE076906		Click to Show/Hide the Full List
mod site	chr6:121447010-121447011:+		[7]
Sequence	GCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGTTGTG
Motif Score	2.168095238
Cell/Tissue List	brain; HEK293; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000649132.1; ENST00000647564.1; ENST00000282561.4; ENST00000650427.1; ENST00000649003.1
External Link	RMBase: m6A_site_732529
mod ID: M6ASITE076907		Click to Show/Hide the Full List
mod site	chr6:121447046-121447047:+		[9]
Sequence	TTGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282561.4; ENST00000647564.1; ENST00000649132.1; ENST00000650427.1; ENST00000649003.1
External Link	RMBase: m6A_site_732530
mod ID: M6ASITE076908		Click to Show/Hide the Full List
mod site	chr6:121447111-121447112:+		[9]
Sequence	TCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649003.1; ENST00000282561.4; ENST00000647564.1; ENST00000650427.1; ENST00000649132.1
External Link	RMBase: m6A_site_732531
mod ID: M6ASITE076909		Click to Show/Hide the Full List
mod site	chr6:121447161-121447162:+		[6]
Sequence	GTGATGCGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGA
Motif Score	2.627720238
Cell/Tissue List	HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000649003.1; ENST00000649132.1; ENST00000282561.4; ENST00000650427.1; ENST00000647564.1
External Link	RMBase: m6A_site_732532
mod ID: M6ASITE076910		Click to Show/Hide the Full List
mod site	chr6:121447166-121447167:+		[6]
Sequence	GCGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000650427.1; ENST00000282561.4; ENST00000649132.1; ENST00000647564.1; ENST00000649003.1
External Link	RMBase: m6A_site_732533
mod ID: M6ASITE076911		Click to Show/Hide the Full List
mod site	chr6:121447182-121447183:+		[6]
Sequence	CTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGA
Motif Score	3.373380952
Cell/Tissue List	HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000649003.1; ENST00000647564.1; ENST00000282561.4; ENST00000650427.1; ENST00000649132.1
External Link	RMBase: m6A_site_732534
mod ID: M6ASITE076912		Click to Show/Hide the Full List
mod site	chr6:121447198-121447199:+		[6]
Sequence	AAGAACTCAAGGTTGCCCAAACTGATGGTGTCAATGTGGAC
Motif Score	2.627720238
Cell/Tissue List	HEK293T; A549; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000647564.1; ENST00000649132.1; ENST00000650427.1; ENST00000282561.4
External Link	RMBase: m6A_site_732535
mod ID: M6ASITE076913		Click to Show/Hide the Full List
mod site	chr6:121447217-121447218:+		[7]
Sequence	AACTGATGGTGTCAATGTGGACATGCACTTGAAGCAGATTG
Motif Score	3.643047619
Cell/Tissue List	HEK293T; brain; A549; hESC-HEK293T; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000282561.4; ENST00000650427.1; ENST00000649003.1; ENST00000649132.1; ENST00000647564.1
External Link	RMBase: m6A_site_732536
mod ID: M6ASITE076914		Click to Show/Hide the Full List
mod site	chr6:121447223-121447224:+		[10]
Sequence	TGGTGTCAATGTGGACATGCACTTGAAGCAGATTGAGATAA
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000650427.1; ENST00000282561.4; ENST00000649132.1; ENST00000647564.1; ENST00000649003.1
External Link	RMBase: m6A_site_732537
mod ID: M6ASITE076915		Click to Show/Hide the Full List
mod site	chr6:121447306-121447307:+		[6]
Sequence	TGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTC
Motif Score	2.930744048
Cell/Tissue List	HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649132.1; ENST00000647564.1; ENST00000649003.1; ENST00000282561.4; ENST00000650427.1
External Link	RMBase: m6A_site_732538
mod ID: M6ASITE076916		Click to Show/Hide the Full List
mod site	chr6:121447310-121447311:+		[9]
Sequence	AGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTCTTCA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000647564.1; ENST00000282561.4; ENST00000649003.1; ENST00000650427.1; ENST00000649132.1
External Link	RMBase: m6A_site_732539
mod ID: M6ASITE076917		Click to Show/Hide the Full List
mod site	chr6:121447370-121447371:+		[9]
Sequence	CTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGCTTGA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282561.4; ENST00000650427.1; ENST00000649132.1; ENST00000649003.1; ENST00000647564.1
External Link	RMBase: m6A_site_732540
mod ID: M6ASITE076918		Click to Show/Hide the Full List
mod site	chr6:121447436-121447437:+		[6]
Sequence	TCCCTGCCCACATCAGGTGGACTGTTTCCTCTCTCGCCCCA
Motif Score	4.065041667
Cell/Tissue List	HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000650427.1; ENST00000647564.1; ENST00000282561.4; ENST00000649132.1; ENST00000649003.1
External Link	RMBase: m6A_site_732541
mod ID: M6ASITE076919		Click to Show/Hide the Full List
mod site	chr6:121447465-121447466:+		[6]
Sequence	TCTCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATG
Motif Score	2.185083333
Cell/Tissue List	HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000647564.1; ENST00000649003.1; ENST00000650427.1; ENST00000282561.4; ENST00000649132.1
External Link	RMBase: m6A_site_732542
mod ID: M6ASITE076920		Click to Show/Hide the Full List
mod site	chr6:121447527-121447528:+		[6]
Sequence	CTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAA
Motif Score	3.373380952
Cell/Tissue List	HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000649132.1; ENST00000649003.1; ENST00000650427.1; ENST00000647564.1; ENST00000282561.4
External Link	RMBase: m6A_site_732543
mod ID: M6ASITE076921		Click to Show/Hide the Full List
mod site	chr6:121447594-121447595:+		[11]
Sequence	AGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCT
Motif Score	2.844928571
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000647564.1; ENST00000650427.1; ENST00000649003.1; ENST00000649132.1; ENST00000282561.4
External Link	RMBase: m6A_site_732544
mod ID: M6ASITE076922		Click to Show/Hide the Full List
mod site	chr6:121447622-121447623:+		[6]
Sequence	TGCGCTGAGCCCTGCCAAAGACTGTGGGTCTCAAAAATATG
Motif Score	3.319380952
Cell/Tissue List	HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000282561.4; ENST00000649003.1; ENST00000650427.1; ENST00000647564.1; ENST00000649132.1
External Link	RMBase: m6A_site_732545
mod ID: M6ASITE076923		Click to Show/Hide the Full List
mod site	chr6:121447727-121447728:+		[6]
Sequence	GCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAATT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; A549; hESC-HEK293T; HepG2; U2OS; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000649132.1; ENST00000282561.4; ENST00000649003.1; ENST00000650427.1; ENST00000647564.1
External Link	RMBase: m6A_site_732546
mod ID: M6ASITE076924		Click to Show/Hide the Full List
mod site	chr6:121447772-121447773:+		[6]
Sequence	CAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAG
Motif Score	2.627720238
Cell/Tissue List	HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000647564.1; ENST00000282561.4; ENST00000650427.1; ENST00000649003.1; ENST00000649132.1
External Link	RMBase: m6A_site_732547
mod ID: M6ASITE076925		Click to Show/Hide the Full List
mod site	chr6:121447794-121447795:+		[6]
Sequence	TGGGCTAATTACAGTGCAGAACAAAATCGAATGGGGCAGGC
Motif Score	2.951386905
Cell/Tissue List	HEK293T; A549; hESC-HEK293T; HepG2; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000650427.1; ENST00000647564.1; ENST00000649132.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732548
mod ID: M6ASITE076926		Click to Show/Hide the Full List
mod site	chr6:121447884-121447885:+		[6]
Sequence	GATAACCAGAATTCTAAAAAACTAGCTGCTGGACATGAATT
Motif Score	2.627720238
Cell/Tissue List	HEK293T; A549; HepG2; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000649003.1; ENST00000647564.1; ENST00000282561.4; ENST00000650427.1; ENST00000649132.1
External Link	RMBase: m6A_site_732549
mod ID: M6ASITE076927		Click to Show/Hide the Full List
mod site	chr6:121447896-121447897:+		[7]
Sequence	TCTAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGC
Motif Score	3.643047619
Cell/Tissue List	HEK293T; brain; A549; hESC-HEK293T; HepG2; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000650427.1; ENST00000649003.1; ENST00000649132.1; ENST00000282561.4; ENST00000647564.1
External Link	RMBase: m6A_site_732550
mod ID: M6ASITE076928		Click to Show/Hide the Full List
mod site	chr6:121447925-121447926:+		[6]
Sequence	ACAGCCACTAGCCATTGTGGACCAGCGACCTTCAAGCAGAG
Motif Score	3.622404762
Cell/Tissue List	HEK293T; A549; HepG2; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000649132.1; ENST00000282561.4; ENST00000650427.1; ENST00000647564.1
External Link	RMBase: m6A_site_732551
mod ID: M6ASITE076929		Click to Show/Hide the Full List
mod site	chr6:121447968-121447969:+		[6]
Sequence	AGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTGGA
Motif Score	2.876744048
Cell/Tissue List	HEK293T; A549; HepG2; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000650427.1; ENST00000649132.1; ENST00000282561.4; ENST00000647564.1
External Link	RMBase: m6A_site_732552
mod ID: M6ASITE076930		Click to Show/Hide the Full List
mod site	chr6:121448127-121448128:+		[6]
Sequence	TTATTCATGAGGCTTAGAAAACACAAAGACATTAGAATACC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000647564.1; ENST00000282561.4; ENST00000649132.1; ENST00000650427.1
External Link	RMBase: m6A_site_732553
mod ID: M6ASITE076931		Click to Show/Hide the Full List
mod site	chr6:121448135-121448136:+		[6]
Sequence	GAGGCTTAGAAAACACAAAGACATTAGAATACCTAGGTTCA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649132.1; ENST00000650427.1; ENST00000282561.4; ENST00000649003.1; ENST00000647564.1
External Link	RMBase: m6A_site_732554
mod ID: M6ASITE076932		Click to Show/Hide the Full List
mod site	chr6:121448238-121448239:+		[10]
Sequence	TAAAGTAGTGGATTCAAAGAACTTAGATTATAAATAAGAGT
Motif Score	3.373380952
Cell/Tissue List	HEK293T; A549; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA
Seq Type List	MeRIP-seq; DART-seq; m6A-seq
Transcript ID List	ENST00000650427.1; ENST00000647564.1; ENST00000649132.1; ENST00000649003.1; ENST00000282561.4
External Link	RMBase: m6A_site_732555
mod ID: M6ASITE076933		Click to Show/Hide the Full List
mod site	chr6:121448272-121448273:+		[10]
Sequence	TAAGAGTTCCATTAGGTGATACATAGATAAGGGCTTTTTCT
Motif Score	2.110482143
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000650427.1; ENST00000282561.4; ENST00000649003.1; ENST00000649132.1; ENST00000647564.1
External Link	RMBase: m6A_site_732556
mod ID: M6ASITE076934		Click to Show/Hide the Full List
mod site	chr6:121448301-121448302:+		[6]
Sequence	AGGGCTTTTTCTCCCCGCAAACACCCCTAAGAATGGTTCTG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; A549; hESC-HEK293T; fibroblasts; Huh7
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000647564.1; ENST00000649132.1; ENST00000650427.1; ENST00000282561.4
External Link	RMBase: m6A_site_732557
mod ID: M6ASITE076935		Click to Show/Hide the Full List
mod site	chr6:121448377-121448378:+		[12]
Sequence	TATTTTTGTTTTACCAAGAAACTGAAATAATTCTGGCCAGG
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000647564.1; ENST00000282561.4; ENST00000650427.1; ENST00000649132.1; ENST00000649003.1
External Link	RMBase: m6A_site_732558
mod ID: M6ASITE076936		Click to Show/Hide the Full List
mod site	chr6:121448414-121448415:+		[9]
Sequence	CAGGAATAAATACTTCCTGAACATCTTAGGTCTTTTCAACA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000650427.1; ENST00000647564.1; ENST00000649003.1; ENST00000282561.4; ENST00000649132.1
External Link	RMBase: m6A_site_732559
mod ID: M6ASITE076937		Click to Show/Hide the Full List
mod site	chr6:121448473-121448474:+		[9]
Sequence	GTCCTTAAGTCCCTGCTAAAACATTCCATTGTTAAAATTTG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282561.4; ENST00000650427.1; ENST00000649003.1; ENST00000649132.1; ENST00000647564.1
External Link	RMBase: m6A_site_732560
mod ID: M6ASITE076938		Click to Show/Hide the Full List
mod site	chr6:121448589-121448590:+		[9]
Sequence	GGTATCAGTTTAAAATTCAGACAAGGCCCACAGAATAAGAT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; Huh7
Seq Type List	MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000650427.1; ENST00000647564.1; ENST00000649132.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732561
mod ID: M6ASITE076939		Click to Show/Hide the Full List
mod site	chr6:121448656-121448657:+		[9]
Sequence	TTCTTTTTCCATCCACTTGCACAATATCATTACCATCACTT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282561.4; ENST00000647564.1; ENST00000649132.1; ENST00000650427.1; ENST00000649003.1
External Link	RMBase: m6A_site_732562
mod ID: M6ASITE076940		Click to Show/Hide the Full List
mod site	chr6:121448702-121448703:+		[9]
Sequence	TCATTCCTCAGCTACTACTCACATTCATTTAATGGTTTCTG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649003.1; ENST00000649132.1; ENST00000282561.4; ENST00000650427.1; ENST00000647564.1
External Link	RMBase: m6A_site_732563
mod ID: M6ASITE076941		Click to Show/Hide the Full List
mod site	chr6:121448807-121448808:+		[9]
Sequence	CAAGCCATGCTTAATATTTAACAATCACTTATATGTGTGTC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282561.4; ENST00000647564.1; ENST00000650427.1; ENST00000649132.1; ENST00000649003.1
External Link	RMBase: m6A_site_732564
mod ID: M6ASITE076942		Click to Show/Hide the Full List
mod site	chr6:121448859-121448860:+		[10]
Sequence	TTTGTTTGTCATGTATTGGTACAAGCAGATACAGTATAAAC
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000650427.1; ENST00000649132.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732565
mod ID: M6ASITE076943		Click to Show/Hide the Full List
mod site	chr6:121448907-121448908:+		[9]
Sequence	CACAGATTTGAAAATAATGCACATATGGTGTTCAAATTTGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282561.4; ENST00000649132.1; ENST00000650427.1; ENST00000649003.1
External Link	RMBase: m6A_site_732566
mod ID: M6ASITE076944		Click to Show/Hide the Full List
mod site	chr6:121448971-121448972:+		[9]
Sequence	TGTGGGCCAATATGGTGTTTACATTATATAATTCCTGCTGT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000650427.1; ENST00000649003.1; ENST00000282561.4; ENST00000649132.1
External Link	RMBase: m6A_site_732567
mod ID: M6ASITE076945		Click to Show/Hide the Full List
mod site	chr6:121449121-121449122:+		[10]
Sequence	GATATAGCAGTAATGCTATTACTGAAATGAATTTCCTTTTT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000649132.1; ENST00000649003.1; ENST00000650427.1; ENST00000282561.4
External Link	RMBase: m6A_site_732568
mod ID: M6ASITE076946		Click to Show/Hide the Full List
mod site	chr6:121449183-121449184:+		[10]
Sequence	TTGAATGATAGAATTTTAGTACTGTAAACAGGCTTTAGTCA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000649003.1; ENST00000650427.1; ENST00000282561.4; ENST00000649132.1
External Link	RMBase: m6A_site_732569
mod ID: M6ASITE076947		Click to Show/Hide the Full List
mod site	chr6:121449190-121449191:+		[5]
Sequence	ATAGAATTTTAGTACTGTAAACAGGCTTTAGTCATTAATGT
Motif Score	2.20572619
Cell/Tissue List	hNPCs; hESCs; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000282561.4; ENST00000649132.1; ENST00000649003.1; ENST00000650427.1
External Link	RMBase: m6A_site_732570
mod ID: M6ASITE076948		Click to Show/Hide the Full List
mod site	chr6:121449216-121449217:+		[10]
Sequence	TTTAGTCATTAATGTGAGAGACTTAGAAAAAATGCTTAGAG
Motif Score	3.319380952
Cell/Tissue List	HEK293T; hNPCs; hESCs; A549
Seq Type List	DART-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000282561.4; ENST00000649003.1; ENST00000650427.1; ENST00000649132.1
External Link	RMBase: m6A_site_732571
mod ID: M6ASITE076949		Click to Show/Hide the Full List
mod site	chr6:121449240-121449241:+		[5]
Sequence	AGAAAAAATGCTTAGAGTGGACTATTAAATGTGCCTAAATG
Motif Score	4.065041667
Cell/Tissue List	hNPCs; hESCs; A549
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000650427.1; ENST00000282561.4; ENST00000649132.1; ENST00000649003.1
External Link	RMBase: m6A_site_732572
mod ID: M6ASITE076950		Click to Show/Hide the Full List
mod site	chr6:121449302-121449303:+		[9]
Sequence	CTTGGGTTTTCCTACTTAATACACAGTAATTCAGAACTTGT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649003.1; ENST00000650427.1; ENST00000649132.1; ENST00000282561.4
External Link	RMBase: m6A_site_732573
mod ID: M6ASITE076951		Click to Show/Hide the Full List
mod site	chr6:121449317-121449318:+		[8]
Sequence	TTAATACACAGTAATTCAGAACTTGTATTCTATTATGAGTT
Motif Score	3.373380952
Cell/Tissue List	HEK293T; hNPCs; hESCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000650427.1; ENST00000649132.1; ENST00000649003.1; ENST00000282561.4
External Link	RMBase: m6A_site_732574
mod ID: M6ASITE076952		Click to Show/Hide the Full List
mod site	chr6:121449427-121449428:+		[9]
Sequence	TTGAAAGAGGATTCAGTAGTACACATACAACTAATTTATTT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000282561.4; ENST00000649003.1; ENST00000650427.1; ENST00000649132.1
External Link	RMBase: m6A_site_732575
mod ID: M6ASITE076953		Click to Show/Hide the Full List
mod site	chr6:121449450-121449451:+		[8]
Sequence	CATACAACTAATTTATTTGAACTATATGTTGAAGACATCTA
Motif Score	3.373380952
Cell/Tissue List	HEK293T; hNPCs; fibroblasts; A549
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000649132.1; ENST00000650427.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732576
mod ID: M6ASITE076954		Click to Show/Hide the Full List
mod site	chr6:121449464-121449465:+		[9]
Sequence	ATTTGAACTATATGTTGAAGACATCTACCAGTTTCTCCAAA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hESC-HEK293T; hNPCs; fibroblasts; A549
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000649132.1; ENST00000650427.1; ENST00000282561.4; ENST00000649003.1
External Link	RMBase: m6A_site_732577
mod ID: M6ASITE076955		Click to Show/Hide the Full List
mod site	chr6:121449498-121449499:+		[10]
Sequence	CTCCAAATGCCTTTTTTAAAACTCATCACAGAAGATTGGTG
Motif Score	2.627720238
Cell/Tissue List	HEK293T; hNPCs; fibroblasts; A549
Seq Type List	MeRIP-seq; DART-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000649132.1; ENST00000282561.4; ENST00000650427.1
External Link	RMBase: m6A_site_732578
mod ID: M6ASITE076956		Click to Show/Hide the Full List
mod site	chr6:121449569-121449570:+		[8]
Sequence	CATGCATGTCAGCTACATAAACAGTTTTGTACAATGAAAAT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; fibroblasts; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649003.1; ENST00000282561.4; ENST00000649132.1; ENST00000650427.1
External Link	RMBase: m6A_site_732579
mod ID: M6ASITE076957		Click to Show/Hide the Full List
mod site	chr6:121449604-121449605:+		[9]
Sequence	GAAAATTACTAATTTGTTTGACATTCCATGTTAAACTACGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649132.1; ENST00000282561.4; ENST00000650427.1; ENST00000649003.1
External Link	RMBase: m6A_site_732580
mod ID: M6ASITE076958		Click to Show/Hide the Full List
mod site	chr6:121449618-121449619:+
Sequence	TGTTTGACATTCCATGTTAAACTACGGTCATGTTCAGCTTC
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000649003.1; ENST00000282561.4; ENST00000650427.1; ENST00000649132.1
External Link	RMBase: m6A_site_732581
mod ID: M6ASITE076959		Click to Show/Hide the Full List
mod site	chr6:121449655-121449656:+
Sequence	CTTCATTGCATGTAATGTAGACCTAGTCCATCAGATCATGT
Motif Score	2.876744048
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000650427.1; ENST00000649003.1; ENST00000649132.1; ENST00000282561.4
External Link	RMBase: m6A_site_732582
mod ID: M6ASITE076960		Click to Show/Hide the Full List
mod site	chr6:121449722-121449723:+		[9]
Sequence	AAAGTTTTAATTTAGTATAAACATAGCTTCTATATTCCGTG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649132.1; ENST00000282561.4
External Link	RMBase: m6A_site_732583

Pseudouridine (Pseudo)

In total 2 m6A sequence/site(s) in this target gene
mod ID: PSESITE000241		Click to Show/Hide the Full List
mod site	chr6:121443623-121443624:+		[13]
Sequence	TAGAATGTAAATAAAGACTATACTTTCAGGGATCATTTCTA
Transcript ID List	ENST00000649132.1; ENST00000647564.1; ENST00000649003.1; rmsk_2058536; ENST00000650427.1; ENST00000282561.4
External Link	RMBase: Pseudo_site_4332
mod ID: PSESITE000242		Click to Show/Hide the Full List
mod site	chr6:121443627-121443628:+		[14]
Sequence	ATGTAAATAAAGACTATACTTTCAGGGATCATTTCTATAGT
Transcript ID List	ENST00000649003.1; ENST00000649132.1; ENST00000282561.4; rmsk_2058536; ENST00000647564.1; ENST00000650427.1
External Link	RMBase: Pseudo_site_4333

Ref 1	YTHDF3 Induces the Translation of m(6)A-Enriched Gene Transcripts to Promote Breast Cancer Brain Metastasis. Cancer Cell. 2020 Dec 14;38(6):857-871.e7. doi: 10.1016/j.ccell.2020.10.004. Epub 2020 Oct 29.
Ref 2	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 3	High-throughput identification of C/D box snoRNA targets with CLIP and RiboMeth-seq. Nucleic Acids Res. 2017 Mar 17;45(5):2341-2353. doi: 10.1093/nar/gkw1321.
Ref 4	MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic Acids Res. 2018 Jan 4;46(D1):D303-D307. doi: 10.1093/nar/gkx1030.
Ref 5	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 6	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 11	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 12	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 13	snOPY: a small nucleolar RNA orthological gene database. BMC Res Notes. 2013 Oct 23;6:426. doi: 10.1186/1756-0500-6-426.
Ref 14	snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D158-62. doi: 10.1093/nar/gkj002.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map