m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00726)

Target Name	GD1 alpha synthase (ST6GALNAC5)
Synonyms	GD1 alpha synthase; GalNAc alpha-2,6-sialyltransferase V; ST6GalNAc V; ST6GalNAcV; Sialyltransferase 7E; SIAT7-E Click to Show/Hide
Gene Name	ST6GALNAC5
Chromosomal Location	1p31.1
Family	Glycosyltransferase 29 family
Function	Predominantly catalyzes the biosynthesis of ganglioside GD1alpha from GM1b in the brain, by transferring the sialyl group (N-acetyl-alpha-neuraminyl or NeuAc) from CMP-NeuAc to the GalNAc residue on the NeuAc-alpha-2,3-Gal-beta-1,3-GalNAc sequence of GM1b. GD1alpha is a critical molecule in the communication and interaction between neuronal cells and their supportive cells, particularly in brain tissues, and functions as an adhesion molecule in the process of metastasis (By similarity). Also shows activity towards sialyl Lc4Cer (N-acetyl-alpha-neuraminosyl-(2->3)-beta-D-galactosyl-(1->3)-N-acetyl-beta-D-glucosaminyl-(1->3)-beta-D-galactosyl-(1->4)-beta-D-glucosyl-(1<->1')-N-acyl-sphing-4-enine) generating disialyl Lc4Cer, which can lead to the synthesis of disialyl Lewis a (Le(a)), suggested to be a cancer-associated antige . Click to Show/Hide
Gene ID	81849
Uniprot ID	SIA7E_HUMAN
HGNC ID	HGNC:19342
KEGG ID	hsa:81849

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ST6GALNAC5 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Mechanistically, YTHDF3 enhances the translation of m6A-enriched transcripts for GD1 alpha synthase (ST6GALNAC5), GJA1, and EGFR, all associated with breast cancer brain metastasis. This work uncovers an essential role of YTHDF3 in controlling the interaction between cancer cells and brain microenvironment, thereby inducing brain metastatic competence.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Cell metastasis
In-vitro Model	MDA-MB-231Br (After brain metastases of MDA-MB-361 breast adenocarcinoma cells)
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-IBC-3	Breast inflammatory carcinoma	Homo sapiens	CVCL_HC47
	JIMT-1Br3 (After brain metastases of JIMT-1 breast cancer cells)
	JIMT-1	Breast ductal carcinoma	Homo sapiens	CVCL_2077
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
	HCC1954Br (After brain metastases of HCC1954 breast cancer cells)
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	bEnd.3	Cerebrovascular endothelioma cells from mice	Mus musculus	CVCL_0170
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	4T1Br (After brain metastases of 4T1 mouse breast cancer cells)
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For the in vivo brain and bone extravasation and seeding assays, cancer cells labeled with CMFDA C2925 (Thermo fisher scientific) or GFP were injected intracardially into the nude mice. Cell number and injection procedure were described in "Animal Experiments". For the in vivo lung extravasation and seeding assays, cancer cells labeled with GFP (2.5 × 10⁵ cells/mouse) were injected into the tail vein of nude mice. At 24 or 48 hrs later, the mice were sacrificed.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Mechanistically, YTHDF3 enhances the translation of m6A-enriched transcripts for GD1 alpha synthase (ST6GALNAC5), GJA1, and EGFR, all associated with breast cancer brain metastasis. This work uncovers an essential role of YTHDF3 in controlling the interaction between cancer cells and brain microenvironment, thereby inducing brain metastatic competence.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell metastasis
In-vitro Model	MDA-MB-231Br (After brain metastases of MDA-MB-361 breast adenocarcinoma cells)
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-IBC-3	Breast inflammatory carcinoma	Homo sapiens	CVCL_HC47
	JIMT-1Br3 (After brain metastases of JIMT-1 breast cancer cells)
	JIMT-1	Breast ductal carcinoma	Homo sapiens	CVCL_2077
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
	HCC1954Br (After brain metastases of HCC1954 breast cancer cells)
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	bEnd.3	Cerebrovascular endothelioma cells from mice	Mus musculus	CVCL_0170
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	4T1Br (After brain metastases of 4T1 mouse breast cancer cells)
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For the in vivo brain and bone extravasation and seeding assays, cancer cells labeled with CMFDA C2925 (Thermo fisher scientific) or GFP were injected intracardially into the nude mice. Cell number and injection procedure were described in "Animal Experiments". For the in vivo lung extravasation and seeding assays, cancer cells labeled with GFP (2.5 × 10⁵ cells/mouse) were injected into the tail vein of nude mice. At 24 or 48 hrs later, the mice were sacrificed.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00726)

GD1 alpha synthase (ST6GALNAC5)

Adenosine-to-Inosine editing (A-to-I)

In total 12 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009011		Click to Show/Hide the Full List
mod site	chr1:76883063-76883064:+		[2]
Sequence	AGTATACCCAACGTTCTCTTATGTCAGCCACACATCATTCA
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: RNA-editing_site_6648
mod ID: A2ISITE009012		Click to Show/Hide the Full List
mod site	chr1:76903235-76903236:+		[2]
Sequence	AATGGGCAAAGAATCTCAATAGACGTATCTCCATAGAAGGC
Transcript ID List	rmsk_169757; ENST00000318803.6; ENST00000477717.6
External Link	RMBase: RNA-editing_site_6649
mod ID: A2ISITE009013		Click to Show/Hide the Full List
mod site	chr1:77010720-77010721:+		[2]
Sequence	TTTGACCCTGTGGCTCCAGGACACCCCAACACTCTGGACTA
Transcript ID List	ENST00000318803.6; ENST00000477717.6; ENST00000488940.1
External Link	RMBase: RNA-editing_site_6650
mod ID: A2ISITE009014		Click to Show/Hide the Full List
mod site	chr1:77015463-77015464:+		[2]
Sequence	AAGTAATGCTTACTCTGTGAACCCTGTAGCTCAGTCCTCAC
Transcript ID List	ENST00000318803.6; ENST00000477717.6; ENST00000488940.1
External Link	RMBase: RNA-editing_site_6651
mod ID: A2ISITE009015		Click to Show/Hide the Full List
mod site	chr1:77035285-77035286:+		[2]
Sequence	TTAATGTAAATGACTAGATGAAGTGAATTTTCTAACCTTAG
Transcript ID List	ENST00000488940.1; ENST00000477717.6; ENST00000318803.6
External Link	RMBase: RNA-editing_site_6652
mod ID: A2ISITE009016		Click to Show/Hide the Full List
mod site	chr1:77035286-77035287:+		[2]
Sequence	TAATGTAAATGACTAGATGAAGTGAATTTTCTAACCTTAGC
Transcript ID List	ENST00000477717.6; ENST00000318803.6; ENST00000488940.1
External Link	RMBase: RNA-editing_site_6653
mod ID: A2ISITE009017		Click to Show/Hide the Full List
mod site	chr1:77042574-77042575:+		[2]
Sequence	TGAGTACTTATTGTACAATTACTTTATGGACCCCTGCATTC
Transcript ID List	ENST00000318803.6; ENST00000477717.6; ENST00000488940.1
External Link	RMBase: RNA-editing_site_6654
mod ID: A2ISITE009018		Click to Show/Hide the Full List
mod site	chr1:77042579-77042580:+		[2]
Sequence	ACTTATTGTACAATTACTTTATGGACCCCTGCATTCTCTTC
Transcript ID List	ENST00000477717.6; ENST00000318803.6; ENST00000488940.1
External Link	RMBase: RNA-editing_site_6655
mod ID: A2ISITE009019		Click to Show/Hide the Full List
mod site	chr1:77044023-77044024:+		[3]
Sequence	CTTGTCCATTGTTCCCTGTCACCCATTTAGAAGAGAACGCA
Transcript ID List	ENST00000488940.1; ENST00000477717.6; ENST00000318803.6
External Link	RMBase: RNA-editing_site_6656
mod ID: A2ISITE009020		Click to Show/Hide the Full List
mod site	chr1:77044031-77044032:+		[3]
Sequence	TTGTTCCCTGTCACCCATTTAGAAGAGAACGCAAGGGTCCA
Transcript ID List	ENST00000488940.1; ENST00000318803.6; ENST00000477717.6
External Link	RMBase: RNA-editing_site_6657
mod ID: A2ISITE009021		Click to Show/Hide the Full List
mod site	chr1:77044034-77044035:+		[2]
Sequence	TTCCCTGTCACCCATTTAGAAGAGAACGCAAGGGTCCATAA
Transcript ID List	ENST00000318803.6; ENST00000477717.6; ENST00000488940.1
External Link	RMBase: RNA-editing_site_6658
mod ID: A2ISITE009022		Click to Show/Hide the Full List
mod site	chr1:77044044-77044045:+		[3]
Sequence	CCCATTTAGAAGAGAACGCAAGGGTCCATAAAGTAATAGCA
Transcript ID List	ENST00000318803.6; ENST00000488940.1; ENST00000477717.6
External Link	RMBase: RNA-editing_site_6659

N6-methyladenosine (m6A)

In total 35 m6A sequence/site(s) in this target gene
mod ID: M6ASITE032826		Click to Show/Hide the Full List
mod site	chr1:76868699-76868700:+		[4]
Sequence	CGCCCCGGGGTCCCCGCGGGACCGCGGCCACTGGACGGATA
Motif Score	3.622404762
Cell/Tissue List	U2OS; GSC-11; HEK293T
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6; ENST00000480428.1; ENST00000496845.1
External Link	RMBase: m6A_site_36399
mod ID: M6ASITE032827		Click to Show/Hide the Full List
mod site	chr1:76868734-76868735:+		[4]
Sequence	CGGATACCTCGGAGTGGCGGACCACAAGGTGACAGCATGCC
Motif Score	3.622404762
Cell/Tissue List	U2OS; GSC-11; HEK293T
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000496845.1; ENST00000480428.1; ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36400
mod ID: M6ASITE032828		Click to Show/Hide the Full List
mod site	chr1:76868867-76868868:+		[5]
Sequence	CGAAGGCTGGAGGGGAGTGGACCCGCTGGGGTAGGGTGGGC
Motif Score	3.622404762
Cell/Tissue List	H1B; hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000496845.1; ENST00000318803.6; ENST00000480428.1
External Link	RMBase: m6A_site_36401
mod ID: M6ASITE032829		Click to Show/Hide the Full List
mod site	chr1:76868925-76868926:+		[5]
Sequence	GAATTCTTATTTGGAGAAAGACACAAAGTTTTGTAGAAAAT
Motif Score	2.897386905
Cell/Tissue List	H1B; hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000480428.1; ENST00000496845.1; ENST00000477717.6
External Link	RMBase: m6A_site_36402
mod ID: M6ASITE032830		Click to Show/Hide the Full List
mod site	chr1:76868963-76868964:+		[5]
Sequence	AATAGGGGTGAGGTGCGTGGACCCCAAAGCCTAATTTCCCA
Motif Score	3.622404762
Cell/Tissue List	H1B; hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000496845.1; ENST00000480428.1; ENST00000477717.6
External Link	RMBase: m6A_site_36403
mod ID: M6ASITE032831		Click to Show/Hide the Full List
mod site	chr1:76869002-76869003:+		[5]
Sequence	CAGCAGAAATCGGCCCTGGAACTAGAACTCCCTGATCCCCA
Motif Score	3.373380952
Cell/Tissue List	H1B; hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000496845.1; ENST00000480428.1; ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36404
mod ID: M6ASITE032832		Click to Show/Hide the Full List
mod site	chr1:76869008-76869009:+		[5]
Sequence	AAATCGGCCCTGGAACTAGAACTCCCTGATCCCCAGAATTG
Motif Score	3.373380952
Cell/Tissue List	H1B
Seq Type List	m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000477717.6; ENST00000496845.1; ENST00000480428.1
External Link	RMBase: m6A_site_36405
mod ID: M6ASITE032833		Click to Show/Hide the Full List
mod site	chr1:76995493-76995494:+		[6]
Sequence	GAGTCATAGACTCTCCTCAGACTATCTTATTGACGGACAAG
Motif Score	3.319380952
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000488940.1; ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36406
mod ID: M6ASITE032834		Click to Show/Hide the Full List
mod site	chr1:76995509-76995510:+		[6]
Sequence	TCAGACTATCTTATTGACGGACAAGTTACAGGTACTTTTAA
Motif Score	3.643047619
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000488940.1; ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36407
mod ID: M6ASITE032835		Click to Show/Hide the Full List
mod site	chr1:77044225-77044226:+		[6]
Sequence	CCTGAAAATGCACTGCAGGGACTGTGCCCTGGTGACCAGCT
Motif Score	4.065041667
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6; ENST00000488940.1
External Link	RMBase: m6A_site_36408
mod ID: M6ASITE032836		Click to Show/Hide the Full List
mod site	chr1:77044290-77044291:+		[7]
Sequence	AAGGCTCCCAGATTGACCAGACAGAGTGTGTCATCCGCATG
Motif Score	2.897386905
Cell/Tissue List	iSLK; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6; ENST00000488940.1
External Link	RMBase: m6A_site_36409
mod ID: M6ASITE032837		Click to Show/Hide the Full List
mod site	chr1:77044599-77044600:+		[5]
Sequence	ATGAGCTCTTCAAGCAGGAGACTGGCAAAGACAGGTACAAA
Motif Score	3.319380952
Cell/Tissue List	H1A; H1B; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6; ENST00000488940.1
External Link	RMBase: m6A_site_36410
mod ID: M6ASITE032838		Click to Show/Hide the Full List
mod site	chr1:77044609-77044610:+		[5]
Sequence	CAAGCAGGAGACTGGCAAAGACAGGTACAAAGGCACAGGGA
Motif Score	2.897386905
Cell/Tissue List	H1A; H1B; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000488940.1; ENST00000318803.6
External Link	RMBase: m6A_site_36411
mod ID: M6ASITE032839		Click to Show/Hide the Full List
mod site	chr1:77050355-77050356:+		[4]
Sequence	TTATGGCATGGTGCCCCCAGACTTCTGCAGGTAGGATTTAT
Motif Score	3.319380952
Cell/Tissue List	U2OS; hNPCs; hESCs; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36412
mod ID: M6ASITE032840		Click to Show/Hide the Full List
mod site	chr1:77063013-77063014:+		[4]
Sequence	GTACCTTATCATTATTATGAACCTTTTGGACCTGATGAATG
Motif Score	2.930744048
Cell/Tissue List	U2OS; hNPCs; hESCs; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36413
mod ID: M6ASITE032841		Click to Show/Hide the Full List
mod site	chr1:77063022-77063023:+		[4]
Sequence	CATTATTATGAACCTTTTGGACCTGATGAATGTACAATGTA
Motif Score	3.622404762
Cell/Tissue List	U2OS; hNPCs; hESCs; iSLK; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36414
mod ID: M6ASITE032842		Click to Show/Hide the Full List
mod site	chr1:77063111-77063112:+		[8]
Sequence	AGAGAAACGAGTCTTTAAGAACTGGGCACGGACATTCAATA
Motif Score	3.373380952
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36415
mod ID: M6ASITE032843		Click to Show/Hide the Full List
mod site	chr1:77063122-77063123:+		[8]
Sequence	TCTTTAAGAACTGGGCACGGACATTCAATATTCACTTTTTT
Motif Score	3.643047619
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36416
mod ID: M6ASITE032844		Click to Show/Hide the Full List
mod site	chr1:77063150-77063151:+		[8]
Sequence	TATTCACTTTTTTCAACCAGACTGGAAACCAGAATCACTTG
Motif Score	3.319380952
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36417
mod ID: M6ASITE032845		Click to Show/Hide the Full List
mod site	chr1:77063157-77063158:+		[8]
Sequence	TTTTTTCAACCAGACTGGAAACCAGAATCACTTGCTATAAA
Motif Score	2.185083333
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36418
mod ID: M6ASITE032846		Click to Show/Hide the Full List
mod site	chr1:77063193-77063194:+		[8]
Sequence	ATAAATCATCCTGAGAATAAACCTGTGTTCTAAGGAATGAG
Motif Score	2.185083333
Cell/Tissue List	HEK293T; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36419
mod ID: M6ASITE032847		Click to Show/Hide the Full List
mod site	chr1:77063222-77063223:+		[8]
Sequence	CTAAGGAATGAGCATGCCAGACTGTAATCCCAGGTATTCAC
Motif Score	3.319380952
Cell/Tissue List	HEK293T; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36420
mod ID: M6ASITE032848		Click to Show/Hide the Full List
mod site	chr1:77063251-77063252:+		[8]
Sequence	CCAGGTATTCACTGCATCAGACACCGAGACACTGAACTTCC
Motif Score	2.897386905
Cell/Tissue List	HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36421
mod ID: M6ASITE032849		Click to Show/Hide the Full List
mod site	chr1:77063259-77063260:+		[8]
Sequence	TCACTGCATCAGACACCGAGACACTGAACTTCCTGAGCCAC
Motif Score	2.897386905
Cell/Tissue List	HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36422
mod ID: M6ASITE032857		Click to Show/Hide the Full List
mod site	chr1:77063266-77063267:+		[8]
Sequence	ATCAGACACCGAGACACTGAACTTCCTGAGCCACCAGACAG
Motif Score	3.373380952
Cell/Tissue List	HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36423
mod ID: M6ASITE032868		Click to Show/Hide the Full List
mod site	chr1:77063283-77063284:+		[8]
Sequence	TGAACTTCCTGAGCCACCAGACAGGAAAGGGTAGCAGAAAA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36424
mod ID: M6ASITE032879		Click to Show/Hide the Full List
mod site	chr1:77063303-77063304:+		[8]
Sequence	ACAGGAAAGGGTAGCAGAAAACAGCTTCACTCCTCAGGAAG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GSC-11; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36425
mod ID: M6ASITE032890		Click to Show/Hide the Full List
mod site	chr1:77063332-77063333:+		[8]
Sequence	CTCCTCAGGAAGTACCATGGACAGACGCCTACCAGGGGTGA
Motif Score	3.643047619
Cell/Tissue List	HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GSC-11; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36426
mod ID: M6ASITE032901		Click to Show/Hide the Full List
mod site	chr1:77063446-77063447:+		[4]
Sequence	GGTGTTACCTTAGGAGCTGAACATTCAATTCAGTTACACCA
Motif Score	2.951386905
Cell/Tissue List	U2OS; H1A; H1B; hNPCs; hESCs; iSLK; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36427
mod ID: M6ASITE032905		Click to Show/Hide the Full List
mod site	chr1:77063479-77063480:+		[9]
Sequence	TTACACCACTATGACTAAAAACAGTTTGGATCTCTTAGTAT
Motif Score	2.20572619
Cell/Tissue List	brain; U2OS; H1B; hNPCs; hESCs; iSLK; TREX; HEC-1-A
Seq Type List	m6A-REF-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36428
mod ID: M6ASITE032906		Click to Show/Hide the Full List
mod site	chr1:77063510-77063511:+		[4]
Sequence	CTCTTAGTATTGCCTTTGAAACTGCAACATAAGCAACTCAA
Motif Score	2.627720238
Cell/Tissue List	U2OS; hNPCs; hESCs; iSLK; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36429
mod ID: M6ASITE032907		Click to Show/Hide the Full List
mod site	chr1:77063556-77063557:+		[10]
Sequence	TTAGTTGCATTCCTTTATAGACATACCATGTCAAAGACGTT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; U2OS; hESCs; HEC-1-A
Seq Type List	MAZTER-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36430
mod ID: M6ASITE032910		Click to Show/Hide the Full List
mod site	chr1:77063628-77063629:+		[4]
Sequence	TAACCTTTGTCATCTGTTAGACTCTGTATGTGTGATTTGTA
Motif Score	3.319380952
Cell/Tissue List	U2OS; hESCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000477717.6; ENST00000318803.6
External Link	RMBase: m6A_site_36431
mod ID: M6ASITE032921		Click to Show/Hide the Full List
mod site	chr1:77063663-77063664:+		[4]
Sequence	TTTGTAAAAAGCAGGCTGAAACTATGGACATGATTTCTGAA
Motif Score	2.627720238
Cell/Tissue List	U2OS; hESCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36432
mod ID: M6ASITE032932		Click to Show/Hide the Full List
mod site	chr1:77063670-77063671:+		[9]
Sequence	AAAGCAGGCTGAAACTATGGACATGATTTCTGAAGAGCACA
Motif Score	3.643047619
Cell/Tissue List	brain; hESC-HEK293T; U2OS; hESCs
Seq Type List	m6A-REF-seq; MAZTER-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318803.6; ENST00000477717.6
External Link	RMBase: m6A_site_36433

Ref 1	YTHDF3 Induces the Translation of m(6)A-Enriched Gene Transcripts to Promote Breast Cancer Brain Metastasis. Cancer Cell. 2020 Dec 14;38(6):857-871.e7. doi: 10.1016/j.ccell.2020.10.004. Epub 2020 Oct 29.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nat Biotechnol. 2004 Aug;22(8):1001-5. doi: 10.1038/nbt996. Epub 2004 Jul 18.
Ref 4	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.
Ref 5	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 6	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 7	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 8	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 9	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 10	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map