m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00719)
Target Name Elongation factor 1-alpha 2 (EEF1A2)
Synonyms
EF-1-alpha-2; Eukaryotic elongation factor 1 A-2; eEF1A-2; Statin-S1
    Click to Show/Hide
Gene Name EEF1A2
Chromosomal Location 20q13.33
Family TRAFAC class translation factor GTPase superfamily, Classic translation factor GTPase family, EF-Tu/EF-1A subfamily
Function
This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis.
    Click to Show/Hide
Gene ID 1917
Uniprot ID
EF1A2_HUMAN
HGNC ID
HGNC:3192
KEGG ID
hsa:1917
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
EEF1A2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line HepG2 cell line Homo sapiens
Treatment: shMETTL14 HepG2 cells
Control: shCtrl HepG2 cells
 GSE121949
Regulation
logFC: -2.52E+00
p-value: 5.01E-13
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Silencing METTL14 repressed apoptosis of spinal cord neurons and attenuated spinal cord injury by inhibiting m6A modification of Elongation factor 1-alpha 2 (EEF1A2) and activating the Akt/mTOR pathway.
Target Regulation Down regulation
Responsed Disease Injuries of spine or trunk ICD-11: ND51
 Disease Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
mTOR signaling pathway hsa04150
Cell Process Cell apoptosis
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Specifically, rats were anesthetized with an intraperitoneal injection of 4% pentobarbital sodium (35 mg/kg) after weight measurement. To expose the posterior vertebral arch from T8 to T12, an incision was subsequently made on the skin along the dorsomedial line to the aponeurosis and muscle plane. Laminectomy (3 mm) was performed from the caudal end of the T10 vertebra to the caudal end of the T11 vertebra under a dissection stereomicroscope. Infinite Horizons impactor (Infinite Horizons, L.L.C., Lexington, KY, USA) was utilized to induce contusion SCI at the force of 60 kdyn/cm . The incision was sutured, followed by intramuscular injection of 20000 units of penicillin once a day for three days. Incisions of rats in the sham group (N = 10) were sutured after skin incision without modeling surgery and related treatment. SCI rat model was established and SCI rats were assigned to the following groups (N = 10 per group): SCI group (SCI treatment), SCI + sh-NC group (injected with silencing negative control lentivirus after SCI treatment), SCI + sh-METTL14 + sh-EEF1A2 group (injected with silencing EEF1A2 and silencing METTL14 lentivirus after SCI treatment), SCI + oe-NC group (injected with overexpressed EEF1A2 NC lentivirus after SCI treatment), SCI + oe-EEF1A2 group (injected with overexpressed EEF1A2 lentivirus after SCI treatment), SCI + oe-EEF1A2 + H2O group [injected with overexpressed EEF1A2 lentivirus and treated with 50 mg/kg (i.p.) H2O after SCI treatment] and SCI + oe-EEF1A2 + Perifosine group [injected with overexpressed EEF1A2 lentivirus and treated with 50 mg/kg (i.p.) Perifosine after SCI treatment . Lentivirus treatment was conducted three days following laminectomy (on day 0, 1, and 2). sh-NC, sh-METTL14, sh-EEF1A2, oe-NC, and oe-EEF1A2 lentivirus (50 uL/day, 100 nmoL/mL; RiboBio, Guangzhou, China) were intrathecally injected through lumbar puncture for 15 min per day.
Injuries of spine or trunk [ICD-11: ND51]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Silencing METTL14 repressed apoptosis of spinal cord neurons and attenuated spinal cord injury by inhibiting m6A modification of Elongation factor 1-alpha 2 (EEF1A2) and activating the Akt/mTOR pathway.
Responsed Disease Injuries of spine or trunk [ICD-11: ND51]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Down regulation
Pathway Response PI3K-Akt signaling pathway hsa04151
mTOR signaling pathway hsa04150
Cell Process Cell apoptosis
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Specifically, rats were anesthetized with an intraperitoneal injection of 4% pentobarbital sodium (35 mg/kg) after weight measurement. To expose the posterior vertebral arch from T8 to T12, an incision was subsequently made on the skin along the dorsomedial line to the aponeurosis and muscle plane. Laminectomy (3 mm) was performed from the caudal end of the T10 vertebra to the caudal end of the T11 vertebra under a dissection stereomicroscope. Infinite Horizons impactor (Infinite Horizons, L.L.C., Lexington, KY, USA) was utilized to induce contusion SCI at the force of 60 kdyn/cm . The incision was sutured, followed by intramuscular injection of 20000 units of penicillin once a day for three days. Incisions of rats in the sham group (N = 10) were sutured after skin incision without modeling surgery and related treatment. SCI rat model was established and SCI rats were assigned to the following groups (N = 10 per group): SCI group (SCI treatment), SCI + sh-NC group (injected with silencing negative control lentivirus after SCI treatment), SCI + sh-METTL14 + sh-EEF1A2 group (injected with silencing EEF1A2 and silencing METTL14 lentivirus after SCI treatment), SCI + oe-NC group (injected with overexpressed EEF1A2 NC lentivirus after SCI treatment), SCI + oe-EEF1A2 group (injected with overexpressed EEF1A2 lentivirus after SCI treatment), SCI + oe-EEF1A2 + H2O group [injected with overexpressed EEF1A2 lentivirus and treated with 50 mg/kg (i.p.) H2O after SCI treatment] and SCI + oe-EEF1A2 + Perifosine group [injected with overexpressed EEF1A2 lentivirus and treated with 50 mg/kg (i.p.) Perifosine after SCI treatment . Lentivirus treatment was conducted three days following laminectomy (on day 0, 1, and 2). sh-NC, sh-METTL14, sh-EEF1A2, oe-NC, and oe-EEF1A2 lentivirus (50 uL/day, 100 nmoL/mL; RiboBio, Guangzhou, China) were intrathecally injected through lumbar puncture for 15 min per day.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00719)
Elongation factor 1-alpha 2 (EEF1A2)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000054 Click to Show/Hide the Full List
mod site chr20:63494957-63494958:- [2]
Sequence GTGGGCGTGAACAAAATGGACTCCACAGAGCCGGCCTACAG
Cell/Tissue List H1
Seq Type List ac4C-seq
Transcript ID List ENST00000298049.12; ENST00000642899.1; ENST00000217182.6; ENST00000645586.1
External Link RMBase: ac4C_site_1234
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010816 Click to Show/Hide the Full List
mod site chr20:63489570-63489571:- [3]
Sequence AGGCCGGTCTCGAACTCCTGACCTCAAGTGATCCACGTGCG
Transcript ID List ENST00000217182.6; ENST00000298049.12
External Link RMBase: RNA-editing_site_88729
mod ID: A2ISITE010817 Click to Show/Hide the Full List
mod site chr20:63489908-63489909:- [3]
Sequence TGCCCAGCCTTTGAGGTCCTACATTCGTCCTAGAAAAACGC
Transcript ID List ENST00000298049.12; ENST00000217182.6
External Link RMBase: RNA-editing_site_88730
5-methylcytidine (m5C)
In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002796 Click to Show/Hide the Full List
mod site chr20:63488267-63488268:- [4]
Sequence GCCCGCGGCGCGACCCTCCCCGGCGGTGCCGCGCTCCGAAC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000298049.12; ENST00000217182.6
External Link RMBase: m5C_site_29574
mod ID: M5CSITE002797 Click to Show/Hide the Full List
mod site chr20:63488939-63488940:- [4]
Sequence AAGCCCATGTGTGTGGAGAGCTTCTCCCAGTACCCGCCTCT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000298049.12; ENST00000217182.6
External Link RMBase: m5C_site_29575
mod ID: M5CSITE002798 Click to Show/Hide the Full List
mod site chr20:63490740-63490741:- [4]
Sequence CCCCTCACACCCCCTCCCCTCTGCAGGCATTGGCACGGTGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000298049.12; ENST00000217182.6; ENST00000645586.1
External Link RMBase: m5C_site_29576
N6-methyladenosine (m6A)
In total 46 m6A sequence/site(s) in this target gene
mod ID: M6ASITE054443 Click to Show/Hide the Full List
mod site chr20:63488026-63488027:- [5]
Sequence AGTGCCCGTTTTACCAATAAACTGAGCGACCCCAGAGCCGT
Motif Score 2.627720238
Cell/Tissue List HeLa; A549; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000298049.12
External Link RMBase: m6A_site_541443
mod ID: M6ASITE054444 Click to Show/Hide the Full List
mod site chr20:63488248-63488249:- [5]
Sequence CCGGCGGTGCCGCGCTCCGAACCCCGGGCCCGGGCCCCCGC
Motif Score 2.930744048
Cell/Tissue List HeLa; U2OS; A549; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000298049.12; ENST00000217182.6
External Link RMBase: m6A_site_541444
mod ID: M6ASITE054445 Click to Show/Hide the Full List
mod site chr20:63489015-63489016:- [5]
Sequence CTCTGGCAAGAAGCTGGAGGACAACCCCAAGTCCCTGAAGT
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000298049.12
External Link RMBase: m6A_site_541445
mod ID: M6ASITE054446 Click to Show/Hide the Full List
mod site chr20:63489138-63489139:- [5]
Sequence CTCGCAGGTCATCATCCTGAACCACCCGGGGCAGATTAGCG
Motif Score 2.930744048
Cell/Tissue List HeLa; MT4; A549; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000217182.6; ENST00000298049.12
External Link RMBase: m6A_site_541446
mod ID: M6ASITE054447 Click to Show/Hide the Full List
mod site chr20:63490094-63490095:- [5]
Sequence AGCCTGCGTGACAGAGCGAGACTTCGTCTCAAAAGAAAAAA
Motif Score 3.319380952
Cell/Tissue List HeLa; MT4; A549; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000298049.12; ENST00000217182.6; rmsk_5171595; ENST00000645586.1
External Link RMBase: m6A_site_541447
mod ID: M6ASITE054448 Click to Show/Hide the Full List
mod site chr20:63490163-63490164:- [5]
Sequence GAGGCAGGAGAATCGCTTGAACCTGGGAGGCGGAGGTTGCA
Motif Score 2.930744048
Cell/Tissue List HeLa; MT4; A549; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000298049.12; rmsk_5171595; ENST00000645586.1; ENST00000217182.6
External Link RMBase: m6A_site_541448
mod ID: M6ASITE054449 Click to Show/Hide the Full List
mod site chr20:63490259-63490260:- [5]
Sequence ATCCTGGTCAACATGGTGAAACCCCGTCTCTACTAAAAATA
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000645586.1; rmsk_5171595; ENST00000217182.6; ENST00000298049.12
External Link RMBase: m6A_site_541449
mod ID: M6ASITE054450 Click to Show/Hide the Full List
mod site chr20:63490370-63490371:- [5]
Sequence TGGCGTGGGGAGAAAACCAGACCCTCAGGCTGGGCGCAGTG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293A-TOA; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000298049.12; ENST00000645586.1
External Link RMBase: m6A_site_541450
mod ID: M6ASITE054451 Click to Show/Hide the Full List
mod site chr20:63490375-63490376:- [5]
Sequence TGGCCTGGCGTGGGGAGAAAACCAGACCCTCAGGCTGGGCG
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293A-TOA; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000645586.1; ENST00000217182.6; ENST00000298049.12
External Link RMBase: m6A_site_541451
mod ID: M6ASITE054452 Click to Show/Hide the Full List
mod site chr20:63490425-63490426:- [5]
Sequence GCCTGCTGGACAGCAGCAGGACTGTCCTGGGTGAGGCTGCT
Motif Score 4.065041667
Cell/Tissue List HeLa; A549; HEK293A-TOA; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000298049.12; ENST00000645586.1; ENST00000217182.6
External Link RMBase: m6A_site_541452
mod ID: M6ASITE054453 Click to Show/Hide the Full List
mod site chr20:63490436-63490437:- [5]
Sequence AGGGGGCTGGCGCCTGCTGGACAGCAGCAGGACTGTCCTGG
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; HEK293A-TOA; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000298049.12; ENST00000645586.1
External Link RMBase: m6A_site_541453
mod ID: M6ASITE054454 Click to Show/Hide the Full List
mod site chr20:63490524-63490525:- [5]
Sequence GCGGGGCAACGTGTGTGGGGACAGCAAGTCTGACCCGCCGC
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000298049.12; ENST00000645586.1; ENST00000217182.6
External Link RMBase: m6A_site_541454
mod ID: M6ASITE054455 Click to Show/Hide the Full List
mod site chr20:63490551-63490552:- [5]
Sequence GAAGAACGTGTCGGTGAAGGACATCCGGCGGGGCAACGTGT
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000645586.1; ENST00000217182.6; ENST00000298049.12
External Link RMBase: m6A_site_541455
mod ID: M6ASITE054456 Click to Show/Hide the Full List
mod site chr20:63490656-63490657:- [5]
Sequence GGTGACCTTTGCGCCAGTGAACATCACCACTGAGGTGAAGT
Motif Score 2.951386905
Cell/Tissue List HeLa; A549; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000298049.12; ENST00000645586.1
External Link RMBase: m6A_site_541456
mod ID: M6ASITE054457 Click to Show/Hide the Full List
mod site chr20:63490702-63490703:- [5]
Sequence TGCCCGTGGGCCGGGTGGAGACCGGCATCCTGCGGCCGGGC
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000645586.1; ENST00000298049.12
External Link RMBase: m6A_site_541457
mod ID: M6ASITE054458 Click to Show/Hide the Full List
mod site chr20:63493180-63493181:- [5]
Sequence GCCCCCCACGCGCCCCACGGACAAGCCCCTGCGCCTGCCGC
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000298049.12; ENST00000645586.1
External Link RMBase: m6A_site_541458
mod ID: M6ASITE054459 Click to Show/Hide the Full List
mod site chr20:63493210-63493211:- [5]
Sequence GTCCCTGCTGGAGGCCCTGGACACCATCCTGCCCCCCACGC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000645586.1; ENST00000298049.12; ENST00000217182.6
External Link RMBase: m6A_site_541459
mod ID: M6ASITE054460 Click to Show/Hide the Full List
mod site chr20:63494895-63494896:- [6]
Sequence CGTCAAGGAAGTCAGCGCCTACATCAAGAAGATCGGCTACA
Motif Score 2.078666667
Cell/Tissue List HEK293; kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000645586.1; ENST00000217182.6; ENST00000298049.12
External Link RMBase: m6A_site_541460
mod ID: M6ASITE054461 Click to Show/Hide the Full List
mod site chr20:63494958-63494959:- [5]
Sequence CGTGGGCGTGAACAAAATGGACTCCACAGAGCCGGCCTACA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; H1A; H1B; hESCs; fibroblasts; A549; MM6; Jurkat; HEK293T; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000298049.12; ENST00000642899.1; ENST00000217182.6; ENST00000645586.1
External Link RMBase: m6A_site_541461
mod ID: M6ASITE054462 Click to Show/Hide the Full List
mod site chr20:63494967-63494968:- [5]
Sequence GCAGCTCATCGTGGGCGTGAACAAAATGGACTCCACAGAGC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; H1A; H1B; hESCs; fibroblasts; A549; MM6; Jurkat; HEK293T; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000645357.1; ENST00000642899.1; ENST00000298049.12; ENST00000217182.6; ENST00000645586.1
External Link RMBase: m6A_site_541462
mod ID: M6ASITE054463 Click to Show/Hide the Full List
mod site chr20:63495096-63495097:- [5]
Sequence GTCCCCTGCCGGGCAGGCGGACTGCGCAGTGCTGATCGTGG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; Huh7; Jurkat; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000298049.12; ENST00000645586.1; ENST00000642899.1; ENST00000645357.1; ENST00000217182.6
External Link RMBase: m6A_site_541463
mod ID: M6ASITE054464 Click to Show/Hide the Full List
mod site chr20:63495877-63495878:- [5]
Sequence CCACCGCGACTTCATCAAGAACATGATCACGGGTACATCCC
Motif Score 2.951386905
Cell/Tissue List HeLa; MT4; A549; Huh7; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000645357.1; ENST00000298049.12; ENST00000217182.6; ENST00000646335.1; ENST00000645586.1; ENST00000642899.1
External Link RMBase: m6A_site_541464
mod ID: M6ASITE054465 Click to Show/Hide the Full List
mod site chr20:63495935-63495936:- [5]
Sequence TCTCCCTCTGGAAGTTCGAGACCACCAAGTACTACATCACC
Motif Score 2.876744048
Cell/Tissue List HeLa; MT4; A549; Huh7; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000645586.1; ENST00000646335.1; ENST00000298049.12; ENST00000217182.6; ENST00000645357.1; ENST00000642899.1
External Link RMBase: m6A_site_541465
mod ID: M6ASITE054466 Click to Show/Hide the Full List
mod site chr20:63495997-63495998:- [5]
Sequence CAAGTATGCCTGGGTGCTGGACAAGCTGAAGGCGGAGCGTG
Motif Score 3.643047619
Cell/Tissue List HeLa; MT4; A549; Huh7; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000645586.1; ENST00000217182.6; ENST00000645357.1; ENST00000642899.1; ENST00000298049.12; ENST00000646335.1
External Link RMBase: m6A_site_541466
mod ID: M6ASITE054467 Click to Show/Hide the Full List
mod site chr20:63496084-63496085:- [5]
Sequence AGCAGCTCGCACCACCAGGGACTCCTGGGTCCCGGGTCCCG
Motif Score 4.065041667
Cell/Tissue List HeLa; A549
Seq Type List m6A-seq
Transcript ID List ENST00000642899.1; ENST00000217182.6; ENST00000645357.1; ENST00000646335.1; ENST00000645586.1; ENST00000298049.12
External Link RMBase: m6A_site_541467
mod ID: M6ASITE054468 Click to Show/Hide the Full List
mod site chr20:63496171-63496172:- [5]
Sequence GAGGGGGCCGGCGTCCCAGGACCCCGACGGAGAGCAAGGGG
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000645357.1; ENST00000646335.1; ENST00000645586.1; ENST00000642899.1; ENST00000298049.12
External Link RMBase: m6A_site_541468
mod ID: M6ASITE054469 Click to Show/Hide the Full List
mod site chr20:63496270-63496271:- [5]
Sequence CTTGCGCCACCTGCTGGTGGACCTGCGTAGCCGCGCCCATT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000298049.12; ENST00000646335.1; ENST00000645357.1; ENST00000642899.1; ENST00000645586.1; ENST00000217182.6
External Link RMBase: m6A_site_541469
mod ID: M6ASITE054470 Click to Show/Hide the Full List
mod site chr20:63496426-63496427:- [5]
Sequence TATTTATCTGACAGCCCCAAACACGGTGGTATTATTGGCCT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000646335.1; ENST00000298049.12; ENST00000645586.1; ENST00000645357.1; ENST00000642899.1; ENST00000217182.6
External Link RMBase: m6A_site_541470
mod ID: M6ASITE054471 Click to Show/Hide the Full List
mod site chr20:63496465-63496466:- [5]
Sequence TTTCTCCTTACCTTAAAAAAACACACACACACAGAGGGTTA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000645586.1; ENST00000645357.1; ENST00000642899.1; ENST00000217182.6; ENST00000646335.1; ENST00000298049.12
External Link RMBase: m6A_site_541471
mod ID: M6ASITE054472 Click to Show/Hide the Full List
mod site chr20:63496745-63496746:- [5]
Sequence CCCATCTGGGTCTGCTCCAGACTGGGCAGCCTCCTGGAGGG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000642899.1; ENST00000298049.12; ENST00000645357.1; ENST00000646335.1; ENST00000217182.6; ENST00000645586.1
External Link RMBase: m6A_site_541472
mod ID: M6ASITE054473 Click to Show/Hide the Full List
mod site chr20:63497001-63497002:- [5]
Sequence ATCCCCATCCCCCACCCAGGACTCTGGGGAGAAGCCCACTC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000645586.1; ENST00000642899.1; ENST00000298049.12; ENST00000645357.1; ENST00000646335.1; ENST00000217182.6
External Link RMBase: m6A_site_541473
mod ID: M6ASITE054474 Click to Show/Hide the Full List
mod site chr20:63497343-63497344:- [5]
Sequence GGTCTGCAGAAGGCTCTGGAACTCTGCCATGTTGAGCTGGG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000645357.1; ENST00000645586.1; ENST00000298049.12; ENST00000642899.1; ENST00000646335.1; ENST00000217182.6
External Link RMBase: m6A_site_541474
mod ID: M6ASITE054475 Click to Show/Hide the Full List
mod site chr20:63497396-63497397:- [5]
Sequence GGTGGCCATCGAGCTGCCGGACTTGCCCTGTGGTGAGGGAG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000646335.1; ENST00000642899.1; ENST00000645586.1; ENST00000645357.1; ENST00000298049.12; ENST00000217182.6
External Link RMBase: m6A_site_541475
mod ID: M6ASITE054476 Click to Show/Hide the Full List
mod site chr20:63497494-63497495:- [5]
Sequence CCTCCTCCAGGGCAGGAGGGACCCCCGCTGTGGGGCACTCA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000646335.1; ENST00000642899.1; ENST00000645357.1; ENST00000645586.1; ENST00000217182.6; ENST00000298049.12; ENST00000643976.1
External Link RMBase: m6A_site_541476
mod ID: M6ASITE054477 Click to Show/Hide the Full List
mod site chr20:63497578-63497579:- [5]
Sequence TCTTGGCCCCCTGAGAAGGAACCCCCAACTCCCGTGGTGGC
Motif Score 2.930744048
Cell/Tissue List HeLa; A549
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000645586.1; ENST00000642899.1; ENST00000643976.1; ENST00000646335.1; ENST00000298049.12; ENST00000645357.1
External Link RMBase: m6A_site_541477
mod ID: M6ASITE054478 Click to Show/Hide the Full List
mod site chr20:63497651-63497652:- [5]
Sequence GCGGAGGTATTGACAAAAGGACCATTGAGAAGTTCGAGAAG
Motif Score 3.622404762
Cell/Tissue List HeLa; A549
Seq Type List m6A-seq
Transcript ID List ENST00000646335.1; ENST00000217182.6; ENST00000645586.1; ENST00000643976.1; ENST00000642899.1; ENST00000298049.12; ENST00000645357.1
External Link RMBase: m6A_site_541478
mod ID: M6ASITE054479 Click to Show/Hide the Full List
mod site chr20:63497713-63497714:- [5]
Sequence CGTGGTCATCGGCCACGTGGACTCCGGAAAGTCCACCACCA
Motif Score 4.065041667
Cell/Tissue List HeLa; A549; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000217182.6; ENST00000642899.1; ENST00000646335.1; ENST00000645586.1; ENST00000298049.12; ENST00000643976.1; ENST00000645357.1
External Link RMBase: m6A_site_541479
mod ID: M6ASITE054480 Click to Show/Hide the Full List
mod site chr20:63497747-63497748:- [5]
Sequence GCAAAATGGGCAAGGAGAAGACCCACATCAACATCGTGGTC
Motif Score 2.876744048
Cell/Tissue List HeLa; A549; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000642899.1; ENST00000646335.1; ENST00000645357.1; ENST00000645586.1; ENST00000298049.12; ENST00000643976.1; ENST00000217182.6
External Link RMBase: m6A_site_541480
mod ID: M6ASITE054481 Click to Show/Hide the Full List
mod site chr20:63497902-63497903:- [5]
Sequence CCTGTCCAGCCTGTGCCAGGACAGTCTCTGCTGGTGTCTCC
Motif Score 3.643047619
Cell/Tissue List HeLa; A549
Seq Type List m6A-seq
Transcript ID List ENST00000642899.1; ENST00000298049.12; ENST00000645586.1; ENST00000217182.6; ENST00000645357.1; ENST00000646335.1; ENST00000643976.1
External Link RMBase: m6A_site_541481
mod ID: M6ASITE054482 Click to Show/Hide the Full List
mod site chr20:63497952-63497953:- [5]
Sequence GGCCCTTCCCTCCCCACCAAACATGGGGGCTTGGTTTGTGG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000643976.1; ENST00000646335.1; ENST00000217182.6; ENST00000645357.1; ENST00000642899.1; ENST00000298049.12; ENST00000645586.1
External Link RMBase: m6A_site_541482
mod ID: M6ASITE054483 Click to Show/Hide the Full List
mod site chr20:63498205-63498206:- [5]
Sequence GAGGGGAGTGCGCGTGCAGGACAGGGCCCTGGAGCGCTGGG
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000645357.1; ENST00000642899.1; ENST00000217182.6; ENST00000643976.1; ENST00000645586.1; ENST00000298049.12; ENST00000646335.1
External Link RMBase: m6A_site_541483
mod ID: M6ASITE054484 Click to Show/Hide the Full List
mod site chr20:63498466-63498467:- [5]
Sequence TTCCTCAGGCTGGAACAGGGACCCCCACCTCCCGGCCGCTG
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000298049.12; ENST00000646335.1; ENST00000217182.6; ENST00000642899.1; ENST00000643976.1; ENST00000645357.1; ENST00000645586.1
External Link RMBase: m6A_site_541484
mod ID: M6ASITE054485 Click to Show/Hide the Full List
mod site chr20:63498472-63498473:- [5]
Sequence TCCTCCTTCCTCAGGCTGGAACAGGGACCCCCACCTCCCGG
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000298049.12; ENST00000646335.1; ENST00000643976.1; ENST00000642899.1; ENST00000645586.1; ENST00000217182.6; ENST00000645357.1
External Link RMBase: m6A_site_541485
mod ID: M6ASITE054486 Click to Show/Hide the Full List
mod site chr20:63499069-63499070:- [7]
Sequence CGCCAGTCCCTCTGGCTGAGACCTCGGCTCCGGGTAAGGAC
Motif Score 2.876744048
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000298049.12; ENST00000217182.6; ENST00000642899.1; ENST00000646335.1; ENST00000645357.1; ENST00000643976.1
External Link RMBase: m6A_site_541486
mod ID: M6ASITE054487 Click to Show/Hide the Full List
mod site chr20:63499106-63499107:- [7]
Sequence GACCCCCTCCCGGAGATAAAACCGCCGGCGCCGGCGCCGCC
Motif Score 2.185083333
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000646335.1; ENST00000645357.1; ENST00000643976.1
External Link RMBase: m6A_site_541487
mod ID: M6ASITE054488 Click to Show/Hide the Full List
mod site chr20:63499125-63499126:- [7]
Sequence CCGCCACCGTCAATAGGTGGACCCCCTCCCGGAGATAAAAC
Motif Score 3.622404762
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000643976.1; ENST00000646335.1; ENST00000645357.1
External Link RMBase: m6A_site_541488
2'-O-Methylation (2'-O-Me)
In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000273 Click to Show/Hide the Full List
mod site chr20:63497711-63497712:- [8]
Sequence TGGTCATCGGCCACGTGGACTCCGGAAAGTCCACCACCACG
Cell/Tissue List HEK293; HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000645586.1; ENST00000645357.1; ENST00000642899.1; ENST00000217182.6; ENST00000643976.1; ENST00000298049.12; ENST00000646335.1
External Link RMBase: Nm_site_3576