m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00718)
Target Name Frizzled-7 (FZD7)
Synonyms
Fz-7; hFz7; FzE3
    Click to Show/Hide
Gene Name FZD7
Chromosomal Location 2q33.1
Family G-protein coupled receptor Fz/Smo family
Function
Receptor for Wnt proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Activation by WNT8 induces expression of beta-catenin target genes (By similarity). Following ligand activation, binds to CCDC88C/DAPLE which displaces DVL1 from FZD7 and leads to inhibition of canonical Wnt signaling, activation of G-proteins by CCDC88C and triggering of non-canonical Wnt responses. May be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.
    Click to Show/Hide
Gene ID 8324
Uniprot ID
FZD7_HUMAN
HGNC ID
HGNC:4045
KEGG ID
hsa:8324
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
FZD7 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between FZD7 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.73E+00 GSE63591
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Mutated YTHDF1 enhanced expression of Frizzled-7 (FZD7), leading to hyperactivation of the Wnt/Bete-catenin pathway and promotion of gastric cancer carcinogenesis.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model MGC-803 Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
In-vivo Model Stable short hairpin (shRNA)-expressing MGC-803 cells (3 × 106) were suspended in 0.1 mL PBS and injected into the flanks of BALB/c mice (n = 8 mice/group) at 5-6 weeks of age. For the flanks injected mice, tumor growth was examined every 3 days. After 5 weeks, mice were sacrificed by cervical dislocation, and weight of xenografts was tested.BALB/c mice were randomly divided into three groups (n = 4 mice/group). A total of 3 × 106 stable shRNA-expressing MGC-803 cells were resuspended in 0.1 mL PBS and injected into the abdominal cavity. After 4 weeks, mice were sacrificed by cervical dislocation, abdominal cavities were opened, and the numbers of implantation metastasis were counted.For the pulmonary metastasis model, NOD/SCID mice were randomly divided into three groups (n = 4 mice/group). A total of 1 × 105 stable shRNA-expressing MGC-803 cells were resuspended in 0.1 mL PBS and injected into the lateral tail vein. After 7 weeks, mice were sacrificed by cervical dislocation, and lungs were extracted and fixed 4% paraformaldehyde in PBS. Paraffin embedding, sectioning, and staining with hematoxylin and eosin were performed. Visible lung metastases were measured and counted using a microscope.
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Mutated YTHDF1 enhanced expression of Frizzled-7 (FZD7), leading to hyperactivation of the Wnt/Bete-catenin pathway and promotion of gastric cancer carcinogenesis.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model MGC-803 Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
In-vivo Model Stable short hairpin (shRNA)-expressing MGC-803 cells (3 × 106) were suspended in 0.1 mL PBS and injected into the flanks of BALB/c mice (n = 8 mice/group) at 5-6 weeks of age. For the flanks injected mice, tumor growth was examined every 3 days. After 5 weeks, mice were sacrificed by cervical dislocation, and weight of xenografts was tested.BALB/c mice were randomly divided into three groups (n = 4 mice/group). A total of 3 × 106 stable shRNA-expressing MGC-803 cells were resuspended in 0.1 mL PBS and injected into the abdominal cavity. After 4 weeks, mice were sacrificed by cervical dislocation, abdominal cavities were opened, and the numbers of implantation metastasis were counted.For the pulmonary metastasis model, NOD/SCID mice were randomly divided into three groups (n = 4 mice/group). A total of 1 × 105 stable shRNA-expressing MGC-803 cells were resuspended in 0.1 mL PBS and injected into the lateral tail vein. After 7 weeks, mice were sacrificed by cervical dislocation, and lungs were extracted and fixed 4% paraformaldehyde in PBS. Paraffin embedding, sectioning, and staining with hematoxylin and eosin were performed. Visible lung metastases were measured and counted using a microscope.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00718)
Frizzled-7 (FZD7)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000035 Click to Show/Hide the Full List
mod site chr2:202037322-202037323:+
Sequence AACTTTTATAGGCAAAGCAGCGCAAATCTGAGGTTTCCCGT
Cell/Tissue List DLD1
Seq Type List acRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: ac4C_site_1157
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002502 Click to Show/Hide the Full List
mod site chr2:202034933-202034934:+
Sequence GGTGAAGGTGCAGTGTTCTCCCGAACTCCGCTTTTTCTTAT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m5C_site_27724
N6-methyladenosine (m6A)
In total 46 m6A sequence/site(s) in this target gene
mod ID: M6ASITE049652 Click to Show/Hide the Full List
mod site chr2:202034654-202034655:+ [2]
Sequence CTCGCGGCCGGCGATGCGGGACCCCGGCGCGGCCGCTCCGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; H1A; H1B; GSC-11; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506910
mod ID: M6ASITE049653 Click to Show/Hide the Full List
mod site chr2:202034780-202034781:+ [2]
Sequence GAAGGGCATCTCCGTGCCGGACCACGGCTTCTGCCAGCCCA
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506911
mod ID: M6ASITE049654 Click to Show/Hide the Full List
mod site chr2:202034822-202034823:+ [2]
Sequence CTCCATCCCGCTGTGCACGGACATCGCCTACAACCAGACCA
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506912
mod ID: M6ASITE049655 Click to Show/Hide the Full List
mod site chr2:202034839-202034840:+ [2]
Sequence CGGACATCGCCTACAACCAGACCATCCTGCCCAACCTGCTG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506913
mod ID: M6ASITE049656 Click to Show/Hide the Full List
mod site chr2:202034870-202034871:+ [2]
Sequence CAACCTGCTGGGCCACACGAACCAAGAGGACGCGGGCCTCG
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506914
mod ID: M6ASITE049657 Click to Show/Hide the Full List
mod site chr2:202034937-202034938:+ [2]
Sequence AAGGTGCAGTGTTCTCCCGAACTCCGCTTTTTCTTATGCTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506915
mod ID: M6ASITE049658 Click to Show/Hide the Full List
mod site chr2:202035053-202035054:+ [2]
Sequence GGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGC
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506916
mod ID: M6ASITE049659 Click to Show/Hide the Full List
mod site chr2:202035095-202035096:+ [2]
Sequence CGAGCGGCTGCGCTGCGAGAACTTCCCGGTGCACGGTGCGG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506917
mod ID: M6ASITE049660 Click to Show/Hide the Full List
mod site chr2:202035137-202035138:+ [2]
Sequence CGAGATCTGCGTGGGCCAGAACACGTCGGACGGCTCCGGGG
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506918
mod ID: M6ASITE049661 Click to Show/Hide the Full List
mod site chr2:202035206-202035207:+ [2]
Sequence TACCGCGCCCTACCTGCCGGACCTGCCCTTCACCGCGCTGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506919
mod ID: M6ASITE049662 Click to Show/Hide the Full List
mod site chr2:202035351-202035352:+ [2]
Sequence GATTGTGGCGCCCCGTGCGAACCGGGCCGTGCCAACGGCCT
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hESCs; GSC-11; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506920
mod ID: M6ASITE049663 Click to Show/Hide the Full List
mod site chr2:202035479-202035480:+ [2]
Sequence CGTTCTCACCTACCTGGTGGACATGCGGCGCTTCAGCTACC
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1B; hESCs; GSC-11; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506921
mod ID: M6ASITE049664 Click to Show/Hide the Full List
mod site chr2:202035578-202035579:+ [2]
Sequence GGCCGGCTTCCTTCTAGAGGACCGCGCCGTGTGCGTGGAGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; H1A; H1B; hESCs; GSC-11; HEK293A-TOA; iSLK; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506922
mod ID: M6ASITE049665 Click to Show/Hide the Full List
mod site chr2:202035608-202035609:+ [3]
Sequence GTGCGTGGAGCGCTTCTCGGACGATGGCTACCGCACGGTGG
Motif Score 3.616982143
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506923
mod ID: M6ASITE049666 Click to Show/Hide the Full List
mod site chr2:202035823-202035824:+ [2]
Sequence GGGCCGTGCCCGCCGTCAAGACCATCACTATCCTGGCCATG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506924
mod ID: M6ASITE049667 Click to Show/Hide the Full List
mod site chr2:202035860-202035861:+ [2]
Sequence CATGGGCCAGGTAGACGGGGACCTGCTGAGCGGGGTGTGCT
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1A; H1B; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; TREX; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506925
mod ID: M6ASITE049668 Click to Show/Hide the Full List
mod site chr2:202036011-202036012:+ [2]
Sequence CGTATCCGCACCATCATGAAACACGACGGCACCAAGACCGA
Motif Score 2.20572619
Cell/Tissue List HeLa; A549; hESC-HEK293T; H1A; H1B; GSC-11; iSLK; MSC
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506926
mod ID: M6ASITE049669 Click to Show/Hide the Full List
mod site chr2:202036027-202036028:+ [2]
Sequence TGAAACACGACGGCACCAAGACCGAGAAGCTGGAGAAGCTC
Motif Score 2.876744048
Cell/Tissue List HeLa; iSLK; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506927
mod ID: M6ASITE049670 Click to Show/Hide the Full List
mod site chr2:202036079-202036080:+ [4]
Sequence CGGCGTCTTCAGCGTGCTCTACACAGTGCCCGCCACCATCG
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506928
mod ID: M6ASITE049671 Click to Show/Hide the Full List
mod site chr2:202036303-202036304:+ [2]
Sequence TCTGGATCTGGTCGGGCAAGACCCTGCAGTCGTGGCGCCGC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506929
mod ID: M6ASITE049672 Click to Show/Hide the Full List
mod site chr2:202036335-202036336:+ [2]
Sequence TGGCGCCGCTTCTACCACAGACTTAGCCACAGCAGCAAGGG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506930
mod ID: M6ASITE049673 Click to Show/Hide the Full List
mod site chr2:202036360-202036361:+ [2]
Sequence GCCACAGCAGCAAGGGGGAGACTGCGGTATGAGCCCCGGCC
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506931
mod ID: M6ASITE049674 Click to Show/Hide the Full List
mod site chr2:202036440-202036441:+ [2]
Sequence GAGGCACGGTAGGGAAAAGAACTGCTGGGTGGGGGCCTGTT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506932
mod ID: M6ASITE049675 Click to Show/Hide the Full List
mod site chr2:202036550-202036551:+ [2]
Sequence GGGGTGATTTGGAAAAGAAGACCTGGGTGGAAAGCGGTTTG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506933
mod ID: M6ASITE049676 Click to Show/Hide the Full List
mod site chr2:202036593-202036594:+ [2]
Sequence TGAAAAGATTTCAGGCAAAGACTTGCAGGAAGATGATGATA
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506934
mod ID: M6ASITE049677 Click to Show/Hide the Full List
mod site chr2:202036670-202036671:+ [2]
Sequence GTGCCTAATAGAAGGTTGAGACCAGCAGAGACTGCTGTGAG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506935
mod ID: M6ASITE049678 Click to Show/Hide the Full List
mod site chr2:202036680-202036681:+ [2]
Sequence GAAGGTTGAGACCAGCAGAGACTGCTGTGAGTTTCTCCCGG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506936
mod ID: M6ASITE049679 Click to Show/Hide the Full List
mod site chr2:202036719-202036720:+ [2]
Sequence GGCTCCGAGGCTGAACGGGGACTGTGAGCGATCCCCCTGCT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506937
mod ID: M6ASITE049680 Click to Show/Hide the Full List
mod site chr2:202036762-202036763:+ [2]
Sequence AGGGCGAGTGGCCTGTCCAGACCCCTGTGAGGCCCCGGGAA
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506938
mod ID: M6ASITE049681 Click to Show/Hide the Full List
mod site chr2:202036863-202036864:+ [2]
Sequence GCTTGTCAAGCAGTGGTCAAACCATAATCTCTTTTCACTGG
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; A549; H1A; H1B; peripheral-blood; GSC-11; iSLK; MSC; TREX; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506939
mod ID: M6ASITE049682 Click to Show/Hide the Full List
mod site chr2:202036890-202036891:+ [2]
Sequence TCTCTTTTCACTGGGGCCAAACTGGAGCCCAGATGGGTTAA
Motif Score 2.627720238
Cell/Tissue List HeLa; A549; GSC-11; iSLK; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506940
mod ID: M6ASITE049683 Click to Show/Hide the Full List
mod site chr2:202036924-202036925:+ [2]
Sequence GGGTTAATTTCCAGGGTCAGACATTACGGTCTCTCCTCCCC
Motif Score 2.897386905
Cell/Tissue List HeLa; A549; iSLK; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506941
mod ID: M6ASITE049684 Click to Show/Hide the Full List
mod site chr2:202037259-202037260:+ [4]
Sequence TGTAAGAGACAAAAGAGGAAACAAAAGTGTCTCCCTGTGGA
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506942
mod ID: M6ASITE049685 Click to Show/Hide the Full List
mod site chr2:202037491-202037492:+ [4]
Sequence TTAAATAAATTTAATTCGGAACACATGATCCAACAGACTAT
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506943
mod ID: M6ASITE049686 Click to Show/Hide the Full List
mod site chr2:202037507-202037508:+ [3]
Sequence CGGAACACATGATCCAACAGACTATGTTAAAATATTCAGGG
Motif Score 3.319380952
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506944
mod ID: M6ASITE049687 Click to Show/Hide the Full List
mod site chr2:202037623-202037624:+ [4]
Sequence GGATCCTTTGAGGTAAAAAAACATAATGTCTTCAGCCTCAT
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506945
mod ID: M6ASITE049688 Click to Show/Hide the Full List
mod site chr2:202037724-202037725:+ [4]
Sequence TCCATCAATCTGTTTATTAAACATCATCCATATGCTGACCC
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506946
mod ID: M6ASITE049689 Click to Show/Hide the Full List
mod site chr2:202037793-202037794:+ [5]
Sequence ATCAGCAGATACCATAGTGAACGAAGAGGAAGGTTTGAACC
Motif Score 2.925321429
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506947
mod ID: M6ASITE049690 Click to Show/Hide the Full List
mod site chr2:202037811-202037812:+ [2]
Sequence GAACGAAGAGGAAGGTTTGAACCATGGGCCCCATCTTTAAA
Motif Score 2.930744048
Cell/Tissue List HeLa; fibroblasts; A549
Seq Type List m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506948
mod ID: M6ASITE049691 Click to Show/Hide the Full List
mod site chr2:202037854-202037855:+ [2]
Sequence AAGTCATTAAAAGAAGGTAAACTTCAAAGTGATTCTGGAGT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506949
mod ID: M6ASITE049692 Click to Show/Hide the Full List
mod site chr2:202037895-202037896:+ [2]
Sequence TCTTTGAAATGTGCTGGAAGACTTAAATTTATTAATCTTAA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506950
mod ID: M6ASITE049693 Click to Show/Hide the Full List
mod site chr2:202038096-202038097:+ [4]
Sequence TAGAGGGTACTGTAAAGTGTACAAGTTACTTTATATATGTA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506951
mod ID: M6ASITE049694 Click to Show/Hide the Full List
mod site chr2:202038144-202038145:+ [4]
Sequence CTTGAGTGGAACTGCTTTTTACATTAAAGTTAAAATCGATC
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506952
mod ID: M6ASITE049695 Click to Show/Hide the Full List
mod site chr2:202038219-202038220:+ [4]
Sequence GTCAGATTTTTAAAACTCCAACACAGGTTTTGGCATCTTTT
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506953
mod ID: M6ASITE049696 Click to Show/Hide the Full List
mod site chr2:202038346-202038347:+ [4]
Sequence AAAATATATATTGTATTTATACATTTTTACTTTGGATTTTT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506954
mod ID: M6ASITE049697 Click to Show/Hide the Full List
mod site chr2:202038402-202038403:+ [4]
Sequence AAGGTCTACCCCACTTTATCACATGTACAGATCACAAATAA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286201.2
External Link RMBase: m6A_site_506955