m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00674)
Target Name TNF receptor-associated factor 4 (TRAF4)
Synonyms
Cysteine-rich domain associated with RING and Traf domains protein 1; Metastatic lymph node gene 62 protein; MLN 62; RING finger protein 83
    Click to Show/Hide
Gene Name TRAF4
Chromosomal Location 17q11.2
Family TNF receptor-associated factor family, B subfamily
Function
Adapter protein with E3 ligase activity that is involved in many diverse biological processes including cell proliferation, migration, differentiation, DNA repair, platelet activation or apoptosis. Promotes EGFR-mediated signaling by facilitating the dimerization of EGFR and downstream AKT activation thereby promoting cell proliferation. Ubiquitinates SMURF2 through 'Lys-48'-linked ubiquitin chain leading to SMURF2 degradation through the proteasome and subsequently osteogenic differentiation. Promotes 'Lys-63'-mediated ubiquitination of CHK1 which in turn activates cell cycle arrest and activation of DNA repair. In addition, promotes an atypical 'Lys-29'-linked ubiquitination at the C-terminal end of IRS1 which is crucial for insulin-like growth factor (IGF) signal transduction. Regulates activation of NF-kappa-B in response to signaling through Toll-like receptors. Required for normal skeleton development, and for normal development of the respiratory tract (By similarity). Required for activation of RPS6KB1 in response to TNF signaling. Modulates TRAF6 functions. Inhibits adipogenic differentiation by activating pyruvate kinase PKM activity and subsequently the beta-catenin signaling pathway.
    Click to Show/Hide
Gene ID 9618
Uniprot ID
TRAF4_HUMAN
HGNC ID
HGNC:12034
KEGG ID
hsa:9618
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TRAF4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1
Cell Line AGS cell line Homo sapiens
Treatment: shYTHDF1 AGS
Control: shControl AGS
 GSE159425
Regulation
logFC: 8.33E-01
p-value: 9.45E-04
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between TRAF4 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.38E+00 GSE63591
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A-dependent TNF receptor-associated factor 4 (TRAF4) expression upregulation by ALKBH5 and YTHDF1 contributes to curcumin-induced obesity prevention.
Target Regulation Up regulation
Responsed Disease Obesity ICD-11: 5B81
 Disease Info 
Pathway Response Ubiquitin mediated proteolysis hsa04120), Proteasome
Cell Process Ubiquitination degradation
In-vitro Model SVF (Stromal vascular cell fraction (SVF) was isolated from minced inguinal adipose tissue of male C57BL/6J mice (3-4 weeks old))
3T3-L1 Normal Mus musculus CVCL_0123
In-vivo Model Before the tests, animals were fasted for 8 h. l glucose tolerance test (GTT) was conducted during week 11 on the diet. The mice were challenged with 2 g/kg body weight d-glucose (Sigma-Aldrich, USA). Insulin tolerance test (ITT) was conducted during week 12 on the diet. For insulin tolerance test, mice were injected intraperitoneally with 0.75 U/kg body weight insulin (Sigma-Aldrich, USA). For both tests, blood samples were taken from the tail vein and glucose levels were measured at indicated time points after administration using an AlphaTRAK glucometer.
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line 143B cell line Homo sapiens
Treatment: siALKBH5 transfected 143B cells
Control: siControl 143B cells
 GSE154528
Regulation
logFC: -6.18E-01
p-value: 8.54E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A-dependent TNF receptor-associated factor 4 (TRAF4) expression upregulation by ALKBH5 and YTHDF1 contributes to curcumin-induced obesity prevention.
Target Regulation Up regulation
Responsed Disease Obesity ICD-11: 5B81
 Disease Info 
Pathway Response Ubiquitin mediated proteolysis hsa04120), Proteasome
Cell Process Ubiquitination degradation
In-vitro Model SVF (Stromal vascular cell fraction (SVF) was isolated from minced inguinal adipose tissue of male C57BL/6J mice (3-4 weeks old))
3T3-L1 Normal Mus musculus CVCL_0123
In-vivo Model Before the tests, animals were fasted for 8 h. l glucose tolerance test (GTT) was conducted during week 11 on the diet. The mice were challenged with 2 g/kg body weight d-glucose (Sigma-Aldrich, USA). Insulin tolerance test (ITT) was conducted during week 12 on the diet. For insulin tolerance test, mice were injected intraperitoneally with 0.75 U/kg body weight insulin (Sigma-Aldrich, USA). For both tests, blood samples were taken from the tail vein and glucose levels were measured at indicated time points after administration using an AlphaTRAK glucometer.
Obesity [ICD-11: 5B81]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A-dependent TNF receptor-associated factor 4 (TRAF4) expression upregulation by ALKBH5 and YTHDF1 contributes to curcumin-induced obesity prevention.
Responsed Disease Obesity [ICD-11: 5B81]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Ubiquitin mediated proteolysis hsa04120), Proteasome
Cell Process Ubiquitination degradation
In-vitro Model SVF (Stromal vascular cell fraction (SVF) was isolated from minced inguinal adipose tissue of male C57BL/6J mice (3-4 weeks old))
3T3-L1 Normal Mus musculus CVCL_0123
In-vivo Model Before the tests, animals were fasted for 8 h. l glucose tolerance test (GTT) was conducted during week 11 on the diet. The mice were challenged with 2 g/kg body weight d-glucose (Sigma-Aldrich, USA). Insulin tolerance test (ITT) was conducted during week 12 on the diet. For insulin tolerance test, mice were injected intraperitoneally with 0.75 U/kg body weight insulin (Sigma-Aldrich, USA). For both tests, blood samples were taken from the tail vein and glucose levels were measured at indicated time points after administration using an AlphaTRAK glucometer.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary m6A-dependent TNF receptor-associated factor 4 (TRAF4) expression upregulation by ALKBH5 and YTHDF1 contributes to curcumin-induced obesity prevention.
Responsed Disease Obesity [ICD-11: 5B81]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Ubiquitin mediated proteolysis hsa04120), Proteasome
Cell Process Ubiquitination degradation
In-vitro Model SVF (Stromal vascular cell fraction (SVF) was isolated from minced inguinal adipose tissue of male C57BL/6J mice (3-4 weeks old))
3T3-L1 Normal Mus musculus CVCL_0123
In-vivo Model Before the tests, animals were fasted for 8 h. l glucose tolerance test (GTT) was conducted during week 11 on the diet. The mice were challenged with 2 g/kg body weight d-glucose (Sigma-Aldrich, USA). Insulin tolerance test (ITT) was conducted during week 12 on the diet. For insulin tolerance test, mice were injected intraperitoneally with 0.75 U/kg body weight insulin (Sigma-Aldrich, USA). For both tests, blood samples were taken from the tail vein and glucose levels were measured at indicated time points after administration using an AlphaTRAK glucometer.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00674)
TNF receptor-associated factor 4 (TRAF4)
Adenosine-to-Inosine editing (A-to-I)
In total 3 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007787 Click to Show/Hide the Full List
mod site chr17:28745817-28745818:+ [2]
Sequence ACAGCCCTGGCTGGGCCCCAAGCTGCAGGCTAAGCTTCTGC
Transcript ID List ENST00000618771.1; ENST00000461195.5; ENST00000586813.5; ENST00000262396.10; ENST00000475329.5; ENST00000262395.10; ENST00000498540.2; ENST00000394925.5; ENST00000422344.5; ENST00000444415.7
External Link RMBase: RNA-editing_site_56014
mod ID: A2ISITE007788 Click to Show/Hide the Full List
mod site chr17:28745847-28745848:+ [2]
Sequence TAAGCTTCTGCCTGAAGCCTAGGGACTTGCCTCTGTCCCCT
Transcript ID List ENST00000618771.1; ENST00000422344.5; ENST00000498540.2; ENST00000262396.10; ENST00000586813.5; ENST00000475329.5; ENST00000444415.7; ENST00000262395.10; ENST00000394925.5; ENST00000461195.5
External Link RMBase: RNA-editing_site_56015
mod ID: A2ISITE007789 Click to Show/Hide the Full List
mod site chr17:28746873-28746874:+ [2]
Sequence CAGCGCAGCCAATGAAAACTAACCTAGGGGGAGGGGGTGAC
Transcript ID List ENST00000475329.5; ENST00000262395.10; ENST00000262396.10; ENST00000394925.5; ENST00000584944.5; ENST00000498540.2; ENST00000422344.5; ENST00000444415.7; ENST00000461195.5; ENST00000586813.5; ENST00000618771.1
External Link RMBase: RNA-editing_site_56016
N1-methyladenosine (m1A)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M1ASITE000052 Click to Show/Hide the Full List
mod site chr17:28748367-28748368:+ [3]
Sequence TGCCACCTCTGAGTGCCCCAAGCGCACTCAGCCCTGCACCT
Cell/Tissue List HEK293T
Seq Type List m1A-MAP-seq; m1A-seq
Transcript ID List ENST00000586813.5; ENST00000262396.10; ENST00000580073.1; ENST00000454852.6; ENST00000618771.1; ENST00000473421.1; ENST00000262395.10; ENST00000444415.7; ENST00000461195.5; ENST00000469529.6
External Link RMBase: m1A_site_444
mod ID: M1ASITE000053 Click to Show/Hide the Full List
mod site chr17:28749735-28749736:+ [4]
Sequence ACCACCCTCAGGTGCCTCCAATTGGTGCTTCAGCCCTGGCC
Cell/Tissue List HEK293T
Seq Type List m1A-seq
Transcript ID List ENST00000262395.10; ENST00000444415.7
External Link RMBase: m1A_site_445
5-methylcytidine (m5C)
In total 12 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001018 Click to Show/Hide the Full List
mod site chr17:28744013-28744014:+ [5]
Sequence CCCTGGCCGCGACCGCCAGTCGGCGCCGCCCGGAGCCGGGA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000262395.10; ENST00000618771.1
External Link RMBase: m5C_site_18361
mod ID: M5CSITE001019 Click to Show/Hide the Full List
mod site chr17:28744016-28744017:+ [5]
Sequence TGGCCGCGACCGCCAGTCGGCGCCGCCCGGAGCCGGGAGCG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000618771.1; ENST00000262395.10
External Link RMBase: m5C_site_18362
mod ID: M5CSITE001020 Click to Show/Hide the Full List
mod site chr17:28744018-28744019:+ [5]
Sequence GCCGCGACCGCCAGTCGGCGCCGCCCGGAGCCGGGAGCGCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000262395.10; ENST00000461195.5; ENST00000618771.1; ENST00000478021.1
External Link RMBase: m5C_site_18363
mod ID: M5CSITE001021 Click to Show/Hide the Full List
mod site chr17:28744065-28744066:+ [6]
Sequence GCGAGGCGCGGGCTGTGGGGCCGCCGCGTGCCTGGCCCCGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000262395.10; ENST00000618771.1; ENST00000394925.5; ENST00000461195.5; ENST00000478021.1; ENST00000422344.5; ENST00000444415.7; ENST00000498540.2; ENST00000586813.5
External Link RMBase: m5C_site_18364
mod ID: M5CSITE001022 Click to Show/Hide the Full List
mod site chr17:28744066-28744067:+ [6]
Sequence CGAGGCGCGGGCTGTGGGGCCGCCGCGTGCCTGGCCCCGCT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000262395.10; ENST00000586813.5; ENST00000394925.5; ENST00000478021.1; ENST00000444415.7; ENST00000618771.1; ENST00000498540.2; ENST00000461195.5; ENST00000422344.5
External Link RMBase: m5C_site_18365
mod ID: M5CSITE001023 Click to Show/Hide the Full List
mod site chr17:28744080-28744081:+ [6]
Sequence TGGGGCCGCCGCGTGCCTGGCCCCGCTCGCCCGTGCCGGCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000262395.10; ENST00000394925.5; ENST00000618771.1; ENST00000461195.5; ENST00000498540.2; ENST00000422344.5; ENST00000478021.1; ENST00000444415.7; ENST00000586813.5
External Link RMBase: m5C_site_18366
mod ID: M5CSITE001024 Click to Show/Hide the Full List
mod site chr17:28744081-28744082:+ [6]
Sequence GGGGCCGCCGCGTGCCTGGCCCCGCTCGCCCGTGCCGGCCG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000461195.5; ENST00000422344.5; ENST00000394925.5; ENST00000444415.7; ENST00000478021.1; ENST00000586813.5; ENST00000262395.10; ENST00000618771.1; rmsk_4664083; ENST00000498540.2
External Link RMBase: m5C_site_18367
mod ID: M5CSITE001025 Click to Show/Hide the Full List
mod site chr17:28744082-28744083:+ [6]
Sequence GGGCCGCCGCGTGCCTGGCCCCGCTCGCCCGTGCCGGCCGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000262395.10; ENST00000478021.1; ENST00000394925.5; ENST00000461195.5; ENST00000618771.1; ENST00000498540.2; ENST00000422344.5; ENST00000586813.5; ENST00000444415.7; rmsk_4664083
External Link RMBase: m5C_site_18368
mod ID: M5CSITE001026 Click to Show/Hide the Full List
mod site chr17:28744083-28744084:+ [6]
Sequence GGCCGCCGCGTGCCTGGCCCCGCTCGCCCGTGCCGGCCGCT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000478021.1; ENST00000394925.5; ENST00000586813.5; rmsk_4664083; ENST00000461195.5; ENST00000618771.1; ENST00000262395.10; ENST00000422344.5; ENST00000498540.2; ENST00000444415.7
External Link RMBase: m5C_site_18369
mod ID: M5CSITE001027 Click to Show/Hide the Full List
mod site chr17:28745666-28745667:+ [5]
Sequence CTCCACTGCACAGCCTGGAGCAGCCTCTGCCCTGCCTGTCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000444415.7; ENST00000262395.10; ENST00000475329.5; ENST00000618771.1; ENST00000262396.10; ENST00000461195.5; ENST00000422344.5; ENST00000394925.5; ENST00000586813.5; ENST00000498540.2
External Link RMBase: m5C_site_18370
mod ID: M5CSITE001028 Click to Show/Hide the Full List
mod site chr17:28747240-28747241:+ [5]
Sequence TCTTCAAGTGCCCTGAGGACCAGCTTCCTCTGGACTATGCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000498540.2; ENST00000586813.5; ENST00000422344.5; ENST00000444415.7; ENST00000262395.10; ENST00000473421.1; ENST00000618771.1; ENST00000394925.5; ENST00000584944.5; ENST00000262396.10; ENST00000454852.6; ENST00000461195.5; ENST00000475329.5
External Link RMBase: m5C_site_18371
mod ID: M5CSITE001029 Click to Show/Hide the Full List
mod site chr17:28748938-28748939:+ [5]
Sequence CCCATGGCCTGGGGCTTTGCCAACAGTGCCCTAAGCTGGCA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000454852.6; ENST00000262395.10; ENST00000618771.1; ENST00000444415.7; ENST00000262396.10; ENST00000469529.6
External Link RMBase: m5C_site_18372
N6-methyladenosine (m6A)
In total 48 m6A sequence/site(s) in this target gene
mod ID: M6ASITE031151 Click to Show/Hide the Full List
mod site chr17:28744128-28744129:+ [7]
Sequence CGCCATGCCTGGCTTCGACTACAAGTTCCTGGAGAAGCCCA
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000262396.10; ENST00000586813.5; ENST00000618771.1; ENST00000444415.7; ENST00000461195.5; ENST00000422344.5; ENST00000394925.5; ENST00000262395.10; ENST00000498540.2; ENST00000478021.1
External Link RMBase: m6A_site_354914
mod ID: M6ASITE031152 Click to Show/Hide the Full List
mod site chr17:28745387-28745388:+ [8]
Sequence ACACATTTACTCTCCTACAGACACAGCCCCATTGTCTCCGC
Motif Score 2.897386905
Cell/Tissue List HeLa; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000461195.5; ENST00000478021.1; ENST00000262395.10; ENST00000475329.5; ENST00000422344.5; ENST00000586813.5; ENST00000444415.7; ENST00000618771.1; ENST00000394925.5; ENST00000498540.2; ENST00000262396.10
External Link RMBase: m6A_site_354915
mod ID: M6ASITE031153 Click to Show/Hide the Full List
mod site chr17:28746782-28746783:+ [8]
Sequence GCCCTGGTTCTTGGCAGAGGACCTTCCTGGGGACTGGGCAG
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000475329.5; ENST00000444415.7; ENST00000262395.10; ENST00000618771.1; ENST00000584944.5; ENST00000422344.5; ENST00000586813.5; ENST00000394925.5; ENST00000461195.5; ENST00000262396.10; ENST00000498540.2
External Link RMBase: m6A_site_354916
mod ID: M6ASITE031154 Click to Show/Hide the Full List
mod site chr17:28746794-28746795:+ [8]
Sequence GGCAGAGGACCTTCCTGGGGACTGGGCAGCCTTCGCACTTA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000394925.5; ENST00000586813.5; ENST00000584944.5; ENST00000618771.1; ENST00000262395.10; ENST00000262396.10; ENST00000422344.5; ENST00000444415.7; ENST00000461195.5; ENST00000498540.2; ENST00000475329.5
External Link RMBase: m6A_site_354917
mod ID: M6ASITE031155 Click to Show/Hide the Full List
mod site chr17:28746870-28746871:+ [8]
Sequence TTTCAGCGCAGCCAATGAAAACTAACCTAGGGGGAGGGGGT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000586813.5; ENST00000618771.1; ENST00000262395.10; ENST00000444415.7; ENST00000262396.10; ENST00000422344.5; ENST00000584944.5; ENST00000461195.5; ENST00000498540.2; ENST00000475329.5; ENST00000394925.5
External Link RMBase: m6A_site_354918
mod ID: M6ASITE031156 Click to Show/Hide the Full List
mod site chr17:28747536-28747537:+ [9]
Sequence CCCTTCCGGTGGCAAGCCAGACCTGTGGCTGAGGGCCAGTA
Motif Score 2.876744048
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000262396.10; ENST00000473421.1; ENST00000444415.7; ENST00000461195.5; ENST00000262395.10; ENST00000394925.5; ENST00000498540.2; ENST00000454852.6; ENST00000422344.5; ENST00000618771.1; ENST00000584944.5; ENST00000586813.5; ENST00000475329.5
External Link RMBase: m6A_site_354923
mod ID: M6ASITE031157 Click to Show/Hide the Full List
mod site chr17:28747593-28747594:+ [9]
Sequence AAGGAAGCAGAGCCCCAGGGACAGCCTGGGATTGAGCAGGC
Motif Score 3.643047619
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000394925.5; ENST00000586813.5; ENST00000262395.10; ENST00000618771.1; ENST00000475329.5; ENST00000578917.1; ENST00000422344.5; ENST00000461195.5; ENST00000498540.2; ENST00000473421.1; ENST00000444415.7; ENST00000454852.6; ENST00000262396.10; ENST00000584944.5
External Link RMBase: m6A_site_354924
mod ID: M6ASITE031158 Click to Show/Hide the Full List
mod site chr17:28747852-28747853:+ [10]
Sequence CTACCCCCAGATCTACCCAGACCCGGAGCTGGAAGTACAAG
Motif Score 2.876744048
Cell/Tissue List HeLa; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000454852.6; ENST00000586813.5; ENST00000422344.5; ENST00000584944.5; ENST00000461195.5; ENST00000618771.1; ENST00000262396.10; ENST00000473421.1; ENST00000578917.1; ENST00000444415.7; ENST00000262395.10; ENST00000475329.5; ENST00000469529.6
External Link RMBase: m6A_site_354925
mod ID: M6ASITE031159 Click to Show/Hide the Full List
mod site chr17:28748099-28748100:+ [7]
Sequence AGCCGCCGTGATCTACCTGCACACTTGCAGCATGACTGCCC
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000475329.5; ENST00000262396.10; ENST00000469529.6; ENST00000262395.10; ENST00000584944.5; ENST00000586813.5; ENST00000422344.5; ENST00000618771.1; ENST00000444415.7; ENST00000578917.1; ENST00000461195.5; ENST00000454852.6; ENST00000473421.1
External Link RMBase: m6A_site_354926
mod ID: M6ASITE031160 Click to Show/Hide the Full List
mod site chr17:28748412-28748413:+ [7]
Sequence CACTAAGGAGTTCGTCTTTGACACCATCCAGGTGAGGCCTT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000444415.7; ENST00000262395.10; ENST00000580073.1; ENST00000618771.1; ENST00000461195.5; ENST00000454852.6; ENST00000262396.10; ENST00000586813.5; ENST00000473421.1; ENST00000469529.6
External Link RMBase: m6A_site_354927
mod ID: M6ASITE031161 Click to Show/Hide the Full List
mod site chr17:28748586-28748587:+ [8]
Sequence GGGCACTGTGGCTCGGGAGGACCTGCCAGGCCATCTGAAGG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293A-TOA; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000469529.6; ENST00000586813.5; ENST00000444415.7; ENST00000618771.1; ENST00000262395.10; ENST00000580073.1; ENST00000454852.6; ENST00000262396.10
External Link RMBase: m6A_site_354928
mod ID: M6ASITE031162 Click to Show/Hide the Full List
mod site chr17:28748607-28748608:+ [8]
Sequence CCTGCCAGGCCATCTGAAGGACAGCTGTAACACCGCCCTGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293A-TOA; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000444415.7; ENST00000454852.6; ENST00000618771.1; ENST00000262396.10; ENST00000580073.1; ENST00000262395.10; ENST00000469529.6
External Link RMBase: m6A_site_354929
mod ID: M6ASITE031163 Click to Show/Hide the Full List
mod site chr17:28748646-28748647:+ [8]
Sequence GGTGCTCTGCCCATTCAAAGACTCCGGCTGCAAGCACAGGG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; peripheral-blood; HEK293A-TOA; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000444415.7; ENST00000469529.6; ENST00000454852.6; ENST00000262396.10; ENST00000618771.1; ENST00000262395.10; ENST00000580073.1
External Link RMBase: m6A_site_354930
mod ID: M6ASITE031164 Click to Show/Hide the Full List
mod site chr17:28748661-28748662:+ [11]
Sequence CAAAGACTCCGGCTGCAAGCACAGGGTGAGATGCCCCTTTT
Motif Score 2.830589286
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000580073.1; ENST00000469529.6; ENST00000444415.7; ENST00000262395.10; ENST00000454852.6; ENST00000618771.1; ENST00000262396.10
External Link RMBase: m6A_site_354931
mod ID: M6ASITE031165 Click to Show/Hide the Full List
mod site chr17:28748715-28748716:+ [8]
Sequence TTTTGCCCTTGAAGCCCTAGACAGAGGCTCAGCTTCTGATG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; peripheral-blood; HEK293T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000444415.7; ENST00000262395.10; ENST00000469529.6; ENST00000454852.6; ENST00000580073.1; ENST00000262396.10; ENST00000618771.1
External Link RMBase: m6A_site_354932
mod ID: M6ASITE031166 Click to Show/Hide the Full List
mod site chr17:28749117-28749118:+ [12]
Sequence TGGAAGATTGGCAGCTATGGACGGCGGCTACAGGAGGCCAA
Motif Score 3.616982143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000262396.10; ENST00000444415.7; ENST00000618771.1; ENST00000262395.10
External Link RMBase: m6A_site_354933
mod ID: M6ASITE031167 Click to Show/Hide the Full List
mod site chr17:28749126-28749127:+ [11]
Sequence GGCAGCTATGGACGGCGGCTACAGGAGGCCAAGGCCAAGCC
Motif Score 2.078666667
Cell/Tissue List liver; HEK293T
Seq Type List m6A-REF-seq; DART-seq
Transcript ID List ENST00000618771.1; ENST00000444415.7; ENST00000262395.10; ENST00000262396.10
External Link RMBase: m6A_site_354934
mod ID: M6ASITE031168 Click to Show/Hide the Full List
mod site chr17:28749149-28749150:+ [12]
Sequence GGAGGCCAAGGCCAAGCCCAACCTTGAGTGCTTCAGCCCAG
Motif Score 2.153267857
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000444415.7; ENST00000262395.10; ENST00000618771.1; ENST00000262396.10
External Link RMBase: m6A_site_354935
mod ID: M6ASITE031169 Click to Show/Hide the Full List
mod site chr17:28749194-28749195:+ [7]
Sequence CTACACACATAAGTATGGTTACAAGCTGCAGGTGTCTGCAT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000444415.7; ENST00000262396.10; ENST00000262395.10; ENST00000618771.1
External Link RMBase: m6A_site_354936
mod ID: M6ASITE031170 Click to Show/Hide the Full List
mod site chr17:28749244-28749245:+ [12]
Sequence GCAATGGCAGTGGTGAGGGCACACACCTCTCACTGTACATT
Motif Score 2.830589286
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000262396.10; ENST00000618771.1; ENST00000444415.7; ENST00000262395.10
External Link RMBase: m6A_site_354937
mod ID: M6ASITE031171 Click to Show/Hide the Full List
mod site chr17:28749246-28749247:+ [12]
Sequence AATGGCAGTGGTGAGGGCACACACCTCTCACTGTACATTCG
Motif Score 2.084928571
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000618771.1; ENST00000262395.10; ENST00000262396.10; ENST00000444415.7
External Link RMBase: m6A_site_354938
mod ID: M6ASITE031172 Click to Show/Hide the Full List
mod site chr17:28749287-28749288:+ [11]
Sequence TGTGCTGCCTGGTGCCTTTGACAATCTCCTTGAGTGGCCCT
Motif Score 2.859755952
Cell/Tissue List HEK293; kidney; liver; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000444415.7; ENST00000618771.1; ENST00000262396.10; ENST00000262395.10
External Link RMBase: m6A_site_354939
mod ID: M6ASITE031173 Click to Show/Hide the Full List
mod site chr17:28749363-28749364:+ [8]
Sequence AGCGACCCTGGGCTGGCTAAACCACAGCACGTCACTGAGAC
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262396.10; ENST00000444415.7; ENST00000262395.10; ENST00000618771.1
External Link RMBase: m6A_site_354940
mod ID: M6ASITE031174 Click to Show/Hide the Full List
mod site chr17:28749382-28749383:+ [8]
Sequence AACCACAGCACGTCACTGAGACCTTCCACCCCGACCCAAAC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000444415.7; ENST00000262395.10; ENST00000262396.10; ENST00000618771.1
External Link RMBase: m6A_site_354941
mod ID: M6ASITE031175 Click to Show/Hide the Full List
mod site chr17:28749401-28749402:+ [8]
Sequence GACCTTCCACCCCGACCCAAACTGGAAGAATTTCCAGAAGC
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262396.10; ENST00000262395.10; ENST00000444415.7; ENST00000618771.1
External Link RMBase: m6A_site_354942
mod ID: M6ASITE031176 Click to Show/Hide the Full List
mod site chr17:28749494-28749495:+ [8]
Sequence CAAGTTCATCTCCCACCAGGACATTCGAAAGCGAAACTATG
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; brain; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000444415.7; ENST00000262395.10; ENST00000618771.1; ENST00000262396.10
External Link RMBase: m6A_site_354943
mod ID: M6ASITE031177 Click to Show/Hide the Full List
mod site chr17:28749509-28749510:+ [8]
Sequence CCAGGACATTCGAAAGCGAAACTATGTGCGGGATGATGCAG
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000262395.10; ENST00000618771.1; ENST00000444415.7; ENST00000262396.10
External Link RMBase: m6A_site_354944
mod ID: M6ASITE031178 Click to Show/Hide the Full List
mod site chr17:28749552-28749553:+ [8]
Sequence TTCATCCGTGCTGCTGTTGAACTGCCCCGGAAGATCCTCAG
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000444415.7; ENST00000618771.1; ENST00000262396.10; ENST00000262395.10
External Link RMBase: m6A_site_354945
mod ID: M6ASITE031179 Click to Show/Hide the Full List
mod site chr17:28749603-28749604:+ [13]
Sequence GTGGGGTTCGAGGGGAAAGGACGATGGGGCATGACCTCAGT
Motif Score 3.616982143
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000444415.7; ENST00000262396.10; ENST00000262395.10
External Link RMBase: m6A_site_354946
mod ID: M6ASITE031180 Click to Show/Hide the Full List
mod site chr17:28749638-28749639:+ [8]
Sequence CTCAGTCAGGCACTGGCTGAACTTGGAGAGGGGGCCGGACC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10; ENST00000444415.7; ENST00000262396.10
External Link RMBase: m6A_site_354947
mod ID: M6ASITE031181 Click to Show/Hide the Full List
mod site chr17:28749656-28749657:+ [8]
Sequence GAACTTGGAGAGGGGGCCGGACCCCCGTCAGCTGCTTCTGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000444415.7; ENST00000262395.10
External Link RMBase: m6A_site_354948
mod ID: M6ASITE031182 Click to Show/Hide the Full List
mod site chr17:28749766-28749767:+ [8]
Sequence AGCCCTGGCCCCTGTGGGGAACAGGTCTTGGGGTCATGAAG
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; LCLs; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; TREX; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10; ENST00000444415.7
External Link RMBase: m6A_site_354949
mod ID: M6ASITE031183 Click to Show/Hide the Full List
mod site chr17:28749795-28749796:+ [8]
Sequence GGGGTCATGAAGGGCTGGAAACAAGTGACCCCAGGGCCTGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; TREX; endometrial; HEC-1-A; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000262395.10; ENST00000444415.7
External Link RMBase: m6A_site_354950
mod ID: M6ASITE031184 Click to Show/Hide the Full List
mod site chr17:28749837-28749838:+ [8]
Sequence TCCCTTCTTGGGTAGGGCAGACATGCCTTGGTGCCGGTCAC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1A; H1B; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; endometrial; HEC-1-A; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000444415.7; ENST00000262395.10
External Link RMBase: m6A_site_354952
mod ID: M6ASITE031185 Click to Show/Hide the Full List
mod site chr17:28749865-28749866:+ [12]
Sequence TGGTGCCGGTCACACTCTACACGGACTGAGGTGCCTGCTCA
Motif Score 2.058863095
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000262395.10; ENST00000444415.7
External Link RMBase: m6A_site_354953
mod ID: M6ASITE031186 Click to Show/Hide the Full List
mod site chr17:28749869-28749870:+ [8]
Sequence GCCGGTCACACTCTACACGGACTGAGGTGCCTGCTCAGGTG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; H1B; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000444415.7; ENST00000262395.10
External Link RMBase: m6A_site_354954
mod ID: M6ASITE031187 Click to Show/Hide the Full List
mod site chr17:28750135-28750136:+ [8]
Sequence TCCCTGGGAGGCTCAACCAAACTGAAGGCAAAGAAAGGACC
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354958
mod ID: M6ASITE031188 Click to Show/Hide the Full List
mod site chr17:28750153-28750154:+ [8]
Sequence AAACTGAAGGCAAAGAAAGGACCAGTCAGAGAAGGGCCGCT
Motif Score 3.622404762
Cell/Tissue List HeLa; H1A; H1B; GSC-11; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354959
mod ID: M6ASITE031189 Click to Show/Hide the Full List
mod site chr17:28750237-28750238:+ [8]
Sequence CTCTGATGGACGCCGGGAAAACTGCATCGGGCTTTGTGTGG
Motif Score 2.627720238
Cell/Tissue List HeLa; H1A; H1B; GSC-11; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354960
mod ID: M6ASITE031190 Click to Show/Hide the Full List
mod site chr17:28750451-28750452:+ [8]
Sequence TTATTATTTCATTGAAAAGAACTGTCAAGTGAAATACTTTT
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; hESCs; GM12878; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354961
mod ID: M6ASITE031191 Click to Show/Hide the Full List
mod site chr17:28750572-28750573:+ [8]
Sequence TGAATGCTTTCTAACTCCGAACCCCAGCCACATCCAGGGAC
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; GM12878; Huh7; HEK293A-TOA; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354962
mod ID: M6ASITE031192 Click to Show/Hide the Full List
mod site chr17:28750591-28750592:+ [8]
Sequence AACCCCAGCCACATCCAGGGACTGGGTGTTGAGCAAAAGGG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; GM12878; Huh7; HEK293A-TOA; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354963
mod ID: M6ASITE031193 Click to Show/Hide the Full List
mod site chr17:28750715-28750716:+ [8]
Sequence ATCCACGTTTCACCTATGAAACATGAACAGAGGAGACTGAC
Motif Score 2.20572619
Cell/Tissue List HeLa; Huh7; GSC-11
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354964
mod ID: M6ASITE031194 Click to Show/Hide the Full List
mod site chr17:28750721-28750722:+ [8]
Sequence GTTTCACCTATGAAACATGAACAGAGGAGACTGACTTATCA
Motif Score 2.951386905
Cell/Tissue List HeLa; Huh7; GSC-11
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354965
mod ID: M6ASITE031195 Click to Show/Hide the Full List
mod site chr17:28750730-28750731:+ [8]
Sequence ATGAAACATGAACAGAGGAGACTGACTTATCAGTGATTCTT
Motif Score 3.319380952
Cell/Tissue List HeLa; Huh7; GSC-11
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354966
mod ID: M6ASITE031196 Click to Show/Hide the Full List
mod site chr17:28750763-28750764:+ [8]
Sequence TGATTCTTCCGCGGGTTCGGACAGGGCCTCGATTCTGTTTT
Motif Score 3.643047619
Cell/Tissue List HeLa; Huh7; GSC-11
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354967
mod ID: M6ASITE031197 Click to Show/Hide the Full List
mod site chr17:28750786-28750787:+ [8]
Sequence GGGCCTCGATTCTGTTTTAAACTCCAGTAGTCCCTAGAAAT
Motif Score 2.627720238
Cell/Tissue List HeLa; Huh7; GSC-11
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262395.10
External Link RMBase: m6A_site_354968
mod ID: M6ASITE031198 Click to Show/Hide the Full List
mod site chr17:28750945-28750946:+ [8]
Sequence TTGTTGTAAAGATTAAATGAACTGGTCAGCACACAGTGCCT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List rmsk_4664087; ENST00000262395.10
External Link RMBase: m6A_site_354969