General Information of the m6A Target Gene (ID: M6ATAR00612)
Target Name Neurogenic differentiation factor 1 (NEUROD1)
Synonyms
NeuroD; NeuroD1; Class A basic helix-loop-helix protein 3; bHLHa3
    Click to Show/Hide
Gene Name NEUROD1
Chromosomal Location 2q31.3
Function
Acts as a transcriptional activator: mediates transcriptional activation by binding to E box-containing promoter consensus core sequences 5'-CANNTG-3'. Associates with the p300/CBP transcription coactivator complex to stimulate transcription of the secretin gene as well as the gene encoding the cyclin-dependent kinase inhibitor CDKN1A. Contributes to the regulation of several cell differentiation pathways, like those that promote the formation of early retinal ganglion cells, inner ear sensory neurons, granule cells forming either the cerebellum or the dentate gyrus cell layer of the hippocampus, endocrine islet cells of the pancreas and enteroendocrine cells of the small intestine. Together with PAX6 or SIX3, is required for the regulation of amacrine cell fate specification. Also required for dendrite morphogenesis and maintenance in the cerebellar cortex. Associates with chromatin to enhancer regulatory elements in genes encoding key transcriptional regulators of neurogenesis (By similarity).
    Click to Show/Hide
Gene ID 4760
Uniprot ID
NDF1_HUMAN
HGNC ID
HGNC:7762
KEGG ID
hsa:4760
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NEUROD1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line Embryonic stem cells Mus musculus
Treatment: METTL14 knockout mESCs
Control: Wild type mESCs
GSE156481
Regulation
logFC: -2.82E+00
p-value: 1.42E-13
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The expression of METTL14 is significantly reduced in patients with retinitis pigmentosa (RP). METTL14 regulates the expression of MAP2 via the modification of m6A, resulting in the dysregulation of Neurogenic differentiation factor 1 (NEUROD1) and pathologic changes in RPE cells.
Target Regulation Down regulation
Responsed Disease Disorders of the retina ICD-11: 9B70-9C0Z
In-vitro Model ARPE-19 Normal Homo sapiens CVCL_0145
Disorders of the retina [ICD-11: 9B70-9C0Z]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary The expression of METTL14 is significantly reduced in patients with retinitis pigmentosa (RP). METTL14 regulates the expression of MAP2 via the modification of m6A, resulting in the dysregulation of Neurogenic differentiation factor 1 (NEUROD1) and pathologic changes in RPE cells.
Responsed Disease Disorders of the retina [ICD-11: 9B70-9C0Z]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
Target Regulation Down regulation
In-vitro Model ARPE-19 Normal Homo sapiens CVCL_0145
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00612)
Neurogenic differentiation factor 1 (NEUROD1)
N6-methyladenosine (m6A)
In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE048888 Click to Show/Hide the Full List
mod site chr2:181676997-181676998:- [2]
Sequence GAGATACATTCCCTATCAAAACATATCAATTCAACACATTA
Motif Score 2.20572619
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000497337.1; ENST00000479558.5; ENST00000295108.3
External Link RMBase: m6A_site_502378
mod ID: M6ASITE048889 Click to Show/Hide the Full List
mod site chr2:181677627-181677628:- [2]
Sequence CATTACTGCCTTTGGAAGAAACAGGGGATCAAAGTTCCTGT
Motif Score 2.20572619
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000497337.1; ENST00000295108.3; ENST00000479558.5
External Link RMBase: m6A_site_502379
mod ID: M6ASITE048890 Click to Show/Hide the Full List
mod site chr2:181677755-181677756:- [2]
Sequence TCACCATTTCCGGGAAACGAACCCACTGTGCTTACAGTGAC
Motif Score 2.930744048
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000479558.5; ENST00000497337.1; ENST00000295108.3
External Link RMBase: m6A_site_502380
mod ID: M6ASITE048891 Click to Show/Hide the Full List
mod site chr2:181677868-181677869:- [2]
Sequence TCGCTGCGAGATCCCCATAGACAATATTATGTCCTTCGATA
Motif Score 2.897386905
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000295108.3; ENST00000479558.5; ENST00000497337.1; ENST00000496876.1
External Link RMBase: m6A_site_502381
mod ID: M6ASITE048892 Click to Show/Hide the Full List
mod site chr2:181677996-181677997:- [3]
Sequence AACTTCTCTTTCAAACACGAACCGTCCGCCGAGTTTGAGAA
Motif Score 2.930744048
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000295108.3; ENST00000479558.5; ENST00000496876.1; ENST00000497337.1
External Link RMBase: m6A_site_502382
mod ID: M6ASITE048893 Click to Show/Hide the Full List
mod site chr2:181678002-181678003:- [3]
Sequence AATGGCAACTTCTCTTTCAAACACGAACCGTCCGCCGAGTT
Motif Score 2.20572619
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000479558.5; ENST00000295108.3; ENST00000497337.1; ENST00000496876.1
External Link RMBase: m6A_site_502383
mod ID: M6ASITE048894 Click to Show/Hide the Full List
mod site chr2:181678047-181678048:- [3]
Sequence ACCAGCCCTTCCTTTGATGGACCCCTCAGCCCGCCGCTCAG
Motif Score 3.622404762
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000295108.3; ENST00000479558.5; ENST00000496876.1; ENST00000497337.1
External Link RMBase: m6A_site_502384
mod ID: M6ASITE048895 Click to Show/Hide the Full List
mod site chr2:181678156-181678157:- [3]
Sequence TCCGCCTTACGGTACCATGGACAGCTCCCATGTCTTCCACG
Motif Score 3.643047619
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000295108.3; ENST00000497337.1; ENST00000496876.1; ENST00000479558.5
External Link RMBase: m6A_site_502385
mod ID: M6ASITE048896 Click to Show/Hide the Full List
mod site chr2:181678255-181678256:- [4]
Sequence TCTGCCTGAGCAGAACCAGGACATGCCCCCCCACCTGCCGA
Motif Score 3.643047619
Cell/Tissue List brain; Brain; hNPCs; GSC-11
Seq Type List m6A-REF-seq; m6A-seq
Transcript ID List ENST00000497337.1; ENST00000479558.5; ENST00000295108.3; ENST00000496876.1
External Link RMBase: m6A_site_502386
mod ID: M6ASITE048897 Click to Show/Hide the Full List
mod site chr2:181678261-181678262:- [3]
Sequence GACTTTTCTGCCTGAGCAGAACCAGGACATGCCCCCCCACC
Motif Score 2.930744048
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1
External Link RMBase: m6A_site_502387
mod ID: M6ASITE048898 Click to Show/Hide the Full List
mod site chr2:181678280-181678281:- [3]
Sequence GCCTGCAACTCAATCCTCGGACTTTTCTGCCTGAGCAGAAC
Motif Score 4.065041667
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000497337.1; ENST00000295108.3; ENST00000479558.5
External Link RMBase: m6A_site_502388
mod ID: M6ASITE048899 Click to Show/Hide the Full List
mod site chr2:181678369-181678370:- [3]
Sequence GCGCTCAGGCAAAAGCCCAGACCTGGTCTCCTTCGTTCAGA
Motif Score 2.876744048
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000479558.5; ENST00000295108.3; ENST00000496876.1; ENST00000497337.1
External Link RMBase: m6A_site_502389
mod ID: M6ASITE048900 Click to Show/Hide the Full List
mod site chr2:181678417-181678418:- [3]
Sequence GACTCTGCGCTTGGCCAAGAACTACATCTGGGCTCTGTCGG
Motif Score 3.373380952
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000497337.1; ENST00000496876.1; ENST00000479558.5; ENST00000295108.3
External Link RMBase: m6A_site_502390
mod ID: M6ASITE048901 Click to Show/Hide the Full List
mod site chr2:181678436-181678437:- [3]
Sequence AGAAGCTGTCCAAAATCGAGACTCTGCGCTTGGCCAAGAAC
Motif Score 3.319380952
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000479558.5; ENST00000295108.3; ENST00000496876.1; ENST00000497337.1
External Link RMBase: m6A_site_502391
mod ID: M6ASITE048902 Click to Show/Hide the Full List
mod site chr2:181678495-181678496:- [3]
Sequence CGGACTGAACGCGGCGCTAGACAACCTGCGCAAGGTGGTGC
Motif Score 2.897386905
Cell/Tissue List Brain; hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000479558.5; ENST00000497337.1; ENST00000496876.1; ENST00000295108.3
External Link RMBase: m6A_site_502392
mod ID: M6ASITE048903 Click to Show/Hide the Full List
mod site chr2:181678512-181678513:- [2]
Sequence GAGCGGAACCGCATGCACGGACTGAACGCGGCGCTAGACAA
Motif Score 4.065041667
Cell/Tissue List hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000295108.3; ENST00000496876.1; ENST00000479558.5; ENST00000497337.1
External Link RMBase: m6A_site_502393
mod ID: M6ASITE048904 Click to Show/Hide the Full List
mod site chr2:181678525-181678526:- [2]
Sequence GGCTAACGCCCGGGAGCGGAACCGCATGCACGGACTGAACG
Motif Score 2.930744048
Cell/Tissue List hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1
External Link RMBase: m6A_site_502394
mod ID: M6ASITE048905 Click to Show/Hide the Full List
mod site chr2:181678666-181678667:- [5]
Sequence GGAGGAGGACGAAGATGAGGACCTGGAAGAGGAGGAAGAAG
Motif Score 3.622404762
Cell/Tissue List H1A; hNPCs; LCLs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000497337.1; ENST00000496876.1; ENST00000295108.3; ENST00000479558.5
External Link RMBase: m6A_site_502395
mod ID: M6ASITE048906 Click to Show/Hide the Full List
mod site chr2:181678708-181678709:- [2]
Sequence AACCATGAACGCAGAGGAGGACTCACTGAGGAACGGGGGAG
Motif Score 4.065041667
Cell/Tissue List hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000479558.5; ENST00000496876.1; ENST00000295108.3; ENST00000497337.1
External Link RMBase: m6A_site_502396
mod ID: M6ASITE048907 Click to Show/Hide the Full List
mod site chr2:181678727-181678728:- [2]
Sequence AGAAGGAGGACGACCTCGAAACCATGAACGCAGAGGAGGAC
Motif Score 2.185083333
Cell/Tissue List hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1
External Link RMBase: m6A_site_502397
mod ID: M6ASITE048908 Click to Show/Hide the Full List
mod site chr2:181678750-181678751:- [2]
Sequence GGACGAGGAGCACGAGGCAGACAAGAAGGAGGACGACCTCG
Motif Score 2.897386905
Cell/Tissue List hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1
External Link RMBase: m6A_site_502398
mod ID: M6ASITE048909 Click to Show/Hide the Full List
mod site chr2:181678793-181678794:- [2]
Sequence CCCAAGGTCCTCCAAGCTGGACAGACGAGTGTCTCAGTTCT
Motif Score 3.643047619
Cell/Tissue List hNPCs; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000479558.5; ENST00000497337.1; ENST00000295108.3; ENST00000496876.1
External Link RMBase: m6A_site_502399
mod ID: M6ASITE048911 Click to Show/Hide the Full List
mod site chr2:181678861-181678862:- [2]
Sequence GTTGAATGTAGGAAATCGAAACATGACCAAATCGTACAGCG
Motif Score 2.20572619
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000295108.3; ENST00000497337.1; ENST00000496876.1; ENST00000479558.5
External Link RMBase: m6A_site_502400
mod ID: M6ASITE048912 Click to Show/Hide the Full List
mod site chr2:181680445-181680446:- [2]
Sequence TGAGACTATCACTGCTCAGGACCTACTAACAACAAAGGTAA
Motif Score 3.622404762
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000497337.1; ENST00000479558.5; ENST00000295108.3; ENST00000496876.1
External Link RMBase: m6A_site_502401
mod ID: M6ASITE048913 Click to Show/Hide the Full List
mod site chr2:181680461-181680462:- [2]
Sequence GGAGGCCCCAGGGTTATGAGACTATCACTGCTCAGGACCTA
Motif Score 3.319380952
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000295108.3; ENST00000496876.1; ENST00000497337.1; ENST00000479558.5
External Link RMBase: m6A_site_502402