m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00612)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NEUROD1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL14 | ||
| Cell Line | Embryonic stem cells | Mus musculus |
|
Treatment: METTL14 knockout mESCs
Control: Wild type mESCs
|
GSE156481 | |
| Regulation |
![]() ![]() |
logFC: -2.82E+00 p-value: 1.42E-13 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The expression of METTL14 is significantly reduced in patients with retinitis pigmentosa (RP). METTL14 regulates the expression of MAP2 via the modification of m6A, resulting in the dysregulation of Neurogenic differentiation factor 1 (NEUROD1) and pathologic changes in RPE cells. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Disorders of the retina | ICD-11: 9B70-9C0Z | ||
| In-vitro Model | ARPE-19 | Normal | Homo sapiens | CVCL_0145 |
Disorders of the retina [ICD-11: 9B70-9C0Z]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The expression of METTL14 is significantly reduced in patients with retinitis pigmentosa (RP). METTL14 regulates the expression of MAP2 via the modification of m6A, resulting in the dysregulation of Neurogenic differentiation factor 1 (NEUROD1) and pathologic changes in RPE cells. | |||
| Responsed Disease | Disorders of the retina [ICD-11: 9B70-9C0Z] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Down regulation | |||
| In-vitro Model | ARPE-19 | Normal | Homo sapiens | CVCL_0145 |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00612)
| In total 25 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE048888 | Click to Show/Hide the Full List | ||
| mod site | chr2:181676997-181676998:- | [2] | |
| Sequence | GAGATACATTCCCTATCAAAACATATCAATTCAACACATTA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000497337.1; ENST00000479558.5; ENST00000295108.3 | ||
| External Link | RMBase: m6A_site_502378 | ||
| mod ID: M6ASITE048889 | Click to Show/Hide the Full List | ||
| mod site | chr2:181677627-181677628:- | [2] | |
| Sequence | CATTACTGCCTTTGGAAGAAACAGGGGATCAAAGTTCCTGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000497337.1; ENST00000295108.3; ENST00000479558.5 | ||
| External Link | RMBase: m6A_site_502379 | ||
| mod ID: M6ASITE048890 | Click to Show/Hide the Full List | ||
| mod site | chr2:181677755-181677756:- | [2] | |
| Sequence | TCACCATTTCCGGGAAACGAACCCACTGTGCTTACAGTGAC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000479558.5; ENST00000497337.1; ENST00000295108.3 | ||
| External Link | RMBase: m6A_site_502380 | ||
| mod ID: M6ASITE048891 | Click to Show/Hide the Full List | ||
| mod site | chr2:181677868-181677869:- | [2] | |
| Sequence | TCGCTGCGAGATCCCCATAGACAATATTATGTCCTTCGATA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295108.3; ENST00000479558.5; ENST00000497337.1; ENST00000496876.1 | ||
| External Link | RMBase: m6A_site_502381 | ||
| mod ID: M6ASITE048892 | Click to Show/Hide the Full List | ||
| mod site | chr2:181677996-181677997:- | [3] | |
| Sequence | AACTTCTCTTTCAAACACGAACCGTCCGCCGAGTTTGAGAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295108.3; ENST00000479558.5; ENST00000496876.1; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502382 | ||
| mod ID: M6ASITE048893 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678002-181678003:- | [3] | |
| Sequence | AATGGCAACTTCTCTTTCAAACACGAACCGTCCGCCGAGTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000479558.5; ENST00000295108.3; ENST00000497337.1; ENST00000496876.1 | ||
| External Link | RMBase: m6A_site_502383 | ||
| mod ID: M6ASITE048894 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678047-181678048:- | [3] | |
| Sequence | ACCAGCCCTTCCTTTGATGGACCCCTCAGCCCGCCGCTCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295108.3; ENST00000479558.5; ENST00000496876.1; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502384 | ||
| mod ID: M6ASITE048895 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678156-181678157:- | [3] | |
| Sequence | TCCGCCTTACGGTACCATGGACAGCTCCCATGTCTTCCACG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295108.3; ENST00000497337.1; ENST00000496876.1; ENST00000479558.5 | ||
| External Link | RMBase: m6A_site_502385 | ||
| mod ID: M6ASITE048896 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678255-181678256:- | [4] | |
| Sequence | TCTGCCTGAGCAGAACCAGGACATGCCCCCCCACCTGCCGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | brain; Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-REF-seq; m6A-seq | ||
| Transcript ID List | ENST00000497337.1; ENST00000479558.5; ENST00000295108.3; ENST00000496876.1 | ||
| External Link | RMBase: m6A_site_502386 | ||
| mod ID: M6ASITE048897 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678261-181678262:- | [3] | |
| Sequence | GACTTTTCTGCCTGAGCAGAACCAGGACATGCCCCCCCACC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502387 | ||
| mod ID: M6ASITE048898 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678280-181678281:- | [3] | |
| Sequence | GCCTGCAACTCAATCCTCGGACTTTTCTGCCTGAGCAGAAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000497337.1; ENST00000295108.3; ENST00000479558.5 | ||
| External Link | RMBase: m6A_site_502388 | ||
| mod ID: M6ASITE048899 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678369-181678370:- | [3] | |
| Sequence | GCGCTCAGGCAAAAGCCCAGACCTGGTCTCCTTCGTTCAGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000479558.5; ENST00000295108.3; ENST00000496876.1; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502389 | ||
| mod ID: M6ASITE048900 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678417-181678418:- | [3] | |
| Sequence | GACTCTGCGCTTGGCCAAGAACTACATCTGGGCTCTGTCGG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000497337.1; ENST00000496876.1; ENST00000479558.5; ENST00000295108.3 | ||
| External Link | RMBase: m6A_site_502390 | ||
| mod ID: M6ASITE048901 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678436-181678437:- | [3] | |
| Sequence | AGAAGCTGTCCAAAATCGAGACTCTGCGCTTGGCCAAGAAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000479558.5; ENST00000295108.3; ENST00000496876.1; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502391 | ||
| mod ID: M6ASITE048902 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678495-181678496:- | [3] | |
| Sequence | CGGACTGAACGCGGCGCTAGACAACCTGCGCAAGGTGGTGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Brain; hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000479558.5; ENST00000497337.1; ENST00000496876.1; ENST00000295108.3 | ||
| External Link | RMBase: m6A_site_502392 | ||
| mod ID: M6ASITE048903 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678512-181678513:- | [2] | |
| Sequence | GAGCGGAACCGCATGCACGGACTGAACGCGGCGCTAGACAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295108.3; ENST00000496876.1; ENST00000479558.5; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502393 | ||
| mod ID: M6ASITE048904 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678525-181678526:- | [2] | |
| Sequence | GGCTAACGCCCGGGAGCGGAACCGCATGCACGGACTGAACG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502394 | ||
| mod ID: M6ASITE048905 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678666-181678667:- | [5] | |
| Sequence | GGAGGAGGACGAAGATGAGGACCTGGAAGAGGAGGAAGAAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | H1A; hNPCs; LCLs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000497337.1; ENST00000496876.1; ENST00000295108.3; ENST00000479558.5 | ||
| External Link | RMBase: m6A_site_502395 | ||
| mod ID: M6ASITE048906 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678708-181678709:- | [2] | |
| Sequence | AACCATGAACGCAGAGGAGGACTCACTGAGGAACGGGGGAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000479558.5; ENST00000496876.1; ENST00000295108.3; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502396 | ||
| mod ID: M6ASITE048907 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678727-181678728:- | [2] | |
| Sequence | AGAAGGAGGACGACCTCGAAACCATGAACGCAGAGGAGGAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502397 | ||
| mod ID: M6ASITE048908 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678750-181678751:- | [2] | |
| Sequence | GGACGAGGAGCACGAGGCAGACAAGAAGGAGGACGACCTCG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496876.1; ENST00000479558.5; ENST00000295108.3; ENST00000497337.1 | ||
| External Link | RMBase: m6A_site_502398 | ||
| mod ID: M6ASITE048909 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678793-181678794:- | [2] | |
| Sequence | CCCAAGGTCCTCCAAGCTGGACAGACGAGTGTCTCAGTTCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hNPCs; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000479558.5; ENST00000497337.1; ENST00000295108.3; ENST00000496876.1 | ||
| External Link | RMBase: m6A_site_502399 | ||
| mod ID: M6ASITE048911 | Click to Show/Hide the Full List | ||
| mod site | chr2:181678861-181678862:- | [2] | |
| Sequence | GTTGAATGTAGGAAATCGAAACATGACCAAATCGTACAGCG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295108.3; ENST00000497337.1; ENST00000496876.1; ENST00000479558.5 | ||
| External Link | RMBase: m6A_site_502400 | ||
| mod ID: M6ASITE048912 | Click to Show/Hide the Full List | ||
| mod site | chr2:181680445-181680446:- | [2] | |
| Sequence | TGAGACTATCACTGCTCAGGACCTACTAACAACAAAGGTAA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000497337.1; ENST00000479558.5; ENST00000295108.3; ENST00000496876.1 | ||
| External Link | RMBase: m6A_site_502401 | ||
| mod ID: M6ASITE048913 | Click to Show/Hide the Full List | ||
| mod site | chr2:181680461-181680462:- | [2] | |
| Sequence | GGAGGCCCCAGGGTTATGAGACTATCACTGCTCAGGACCTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295108.3; ENST00000496876.1; ENST00000497337.1; ENST00000479558.5 | ||
| External Link | RMBase: m6A_site_502402 | ||
References

