m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00611)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MAP2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL14 | ||
| Cell Line | mouse embryonic stem cells | Mus musculus |
|
Treatment: METTL14-/- ESCs
Control: Wild type ESCs
|
GSE145309 | |
| Regulation |
![]() ![]() |
logFC: 3.37E+00 p-value: 1.21E-131 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The expression of METTL14 is significantly reduced in patients with retinitis pigmentosa (RP). METTL14 regulates the expression of Microtubule-associated protein 2 (MAP2) via the modification of m6A, resulting in the dysregulation of NEUROD1 and pathologic changes in RPE cells. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Disorders of the retina | ICD-11: 9B70-9C0Z | ||
| In-vitro Model | ARPE-19 | Normal | Homo sapiens | CVCL_0145 |
Disorders of the retina [ICD-11: 9B70-9C0Z]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The expression of METTL14 is significantly reduced in patients with retinitis pigmentosa (RP). METTL14 regulates the expression of Microtubule-associated protein 2 (MAP2) via the modification of m6A, resulting in the dysregulation of NEUROD1 and pathologic changes in RPE cells. | |||
| Responsed Disease | Disorders of the retina [ICD-11: 9B70-9C0Z] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Down regulation | |||
| In-vitro Model | ARPE-19 | Normal | Homo sapiens | CVCL_0145 |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00611)
| In total 7 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE010229 | Click to Show/Hide the Full List | ||
| mod site | chr2:209537235-209537236:+ | [2] | |
| Sequence | AATTATTTTTTGTATCTGTTATGGTGATCTGTGATCAGTGA | ||
| Transcript ID List | rmsk_806502; ENST00000199940.10 | ||
| External Link | RMBase: RNA-editing_site_83308 | ||
| mod ID: A2ISITE010230 | Click to Show/Hide the Full List | ||
| mod site | chr2:209537270-209537271:+ | [2] | |
| Sequence | CAGTGATCTTTGATGTTACTATAGTAATTATTTTGAGACCC | ||
| Transcript ID List | rmsk_806502; ENST00000199940.10 | ||
| External Link | RMBase: RNA-editing_site_83309 | ||
| mod ID: A2ISITE010231 | Click to Show/Hide the Full List | ||
| mod site | chr2:209541226-209541227:+ | [2] | |
| Sequence | TTTTGTAGAGATGGGGTTTCACCATGTTGGACAGGCTGGTC | ||
| Transcript ID List | ENST00000199940.10 | ||
| External Link | RMBase: RNA-editing_site_83310 | ||
| mod ID: A2ISITE010232 | Click to Show/Hide the Full List | ||
| mod site | chr2:209543312-209543313:+ | [2] | |
| Sequence | AATTACAACAGTAACGTCAAAGATCACTGATCATAAATTGC | ||
| Transcript ID List | ENST00000199940.10 | ||
| External Link | RMBase: RNA-editing_site_83311 | ||
| mod ID: A2ISITE010233 | Click to Show/Hide the Full List | ||
| mod site | chr2:209543327-209543328:+ | [2] | |
| Sequence | GTCAAAGATCACTGATCATAAATTGCCATAACAGATATAAA | ||
| Transcript ID List | ENST00000199940.10 | ||
| External Link | RMBase: RNA-editing_site_83312 | ||
| mod ID: A2ISITE010234 | Click to Show/Hide the Full List | ||
| mod site | chr2:209543415-209543416:+ | [2] | |
| Sequence | CAGAAACAGTAAGTGAGCACATGCTGTTGGAAAAATGGCAC | ||
| Transcript ID List | ENST00000199940.10 | ||
| External Link | RMBase: RNA-editing_site_83313 | ||
| mod ID: A2ISITE010235 | Click to Show/Hide the Full List | ||
| mod site | chr2:209689954-209689955:+ | [3] | |
| Sequence | AATGAAGCTAACATAACTTGACTTAGGTAGTCCCTTACCTT | ||
| Transcript ID List | ENST00000361559.8; ENST00000452717.1; ENST00000461253.1; ENST00000471619.5; ENST00000447185.5; ENST00000392194.5; ENST00000360351.8; ENST00000445941.5; ENST00000482864.5; ENST00000199940.10 | ||
| External Link | RMBase: RNA-editing_site_83314 | ||
N6-methyladenosine (m6A)
| In total 89 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE049805 | Click to Show/Hide the Full List | ||
| mod site | chr2:209625086-209625087:+ | [4] | |
| Sequence | ATATTATCAACCCTTTGAGAACACGACACAACGAACTTTAT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000445941.5; ENST00000199940.10; ENST00000361559.8; ENST00000360351.8; ENST00000392193.5; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508858 | ||
| mod ID: M6ASITE049806 | Click to Show/Hide the Full List | ||
| mod site | chr2:209625100-209625101:+ | [4] | |
| Sequence | TTGAGAACACGACACAACGAACTTTATATTTTACCACTTCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000445941.5; ENST00000199940.10; ENST00000361559.8; ENST00000392193.5; ENST00000360351.8; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508859 | ||
| mod ID: M6ASITE049807 | Click to Show/Hide the Full List | ||
| mod site | chr2:209653212-209653213:+ | [4] | |
| Sequence | AAGCAAAGGCACCTCACTGGACCTCAGCACCGCTAACAGAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000199940.10; ENST00000447185.5; ENST00000361559.8; ENST00000392193.5; ENST00000445941.5; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508860 | ||
| mod ID: M6ASITE049808 | Click to Show/Hide the Full List | ||
| mod site | chr2:209653289-209653290:+ | [5] | |
| Sequence | CAAGGCGGAGCAGGGGAAGGACTTGTCCGAAGCGCCAATGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hNPCs; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445941.5; ENST00000361559.8; ENST00000447185.5; ENST00000360351.8; ENST00000392194.5; ENST00000392193.5; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508861 | ||
| mod ID: M6ASITE049809 | Click to Show/Hide the Full List | ||
| mod site | chr2:209653417-209653418:+ | [6] | |
| Sequence | CGGAGAGCTGACCTCAGCTGACAGAGAAACAGCAGGTAACT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000392194.5; ENST00000447185.5; ENST00000392193.5; ENST00000445941.5; ENST00000199940.10; ENST00000361559.8; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508862 | ||
| mod ID: M6ASITE049810 | Click to Show/Hide the Full List | ||
| mod site | chr2:209653425-209653426:+ | [5] | |
| Sequence | TGACCTCAGCTGACAGAGAAACAGCAGGTAACTAAGGGCTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000445941.5; ENST00000360351.8; ENST00000199940.10; ENST00000392193.5; ENST00000392194.5; ENST00000452717.1; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508863 | ||
| mod ID: M6ASITE049811 | Click to Show/Hide the Full List | ||
| mod site | chr2:209661574-209661575:+ | [7] | |
| Sequence | GGTGGCACCGATGGATGAGGACAGAAAATGGGGATCTTTTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000199940.10; ENST00000452717.1; ENST00000392193.5; ENST00000445941.5; ENST00000447185.5; ENST00000482864.5; ENST00000361559.8; ENST00000360351.8; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508864 | ||
| mod ID: M6ASITE049812 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692696-209692697:+ | [5] | |
| Sequence | CTCTACAGCTGAGCCTTCAGACCAGAAGGAAAAGGAGTCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000481649.1; ENST00000392194.5; ENST00000461253.1; ENST00000452717.1; ENST00000360351.8; ENST00000447185.5; ENST00000471619.5; ENST00000445941.5; ENST00000482864.5; ENST00000199940.10; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508865 | ||
| mod ID: M6ASITE049813 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692741-209692742:+ | [5] | |
| Sequence | GCAAAGTAAGCCTGGTGAAGACCTTAAACATGCTGCCTTAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000360351.8; ENST00000461253.1; ENST00000452717.1; ENST00000482864.5; ENST00000471619.5; ENST00000445941.5; ENST00000199940.10; ENST00000481649.1; ENST00000447185.5; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508866 | ||
| mod ID: M6ASITE049814 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692748-209692749:+ | [8] | |
| Sequence | AAGCCTGGTGAAGACCTTAAACATGCTGCCTTAGTTTCTCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Brain; hNPCs; fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000392194.5; ENST00000481649.1; ENST00000452717.1; ENST00000199940.10; ENST00000360351.8; ENST00000445941.5; ENST00000447185.5; ENST00000482864.5; ENST00000361559.8; ENST00000461253.1 | ||
| External Link | RMBase: m6A_site_508867 | ||
| mod ID: M6ASITE049815 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692776-209692777:+ | [8] | |
| Sequence | CCTTAGTTTCTCAGCCAGAGACAACTAAAACTTACCCTGAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Brain; hNPCs; fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000199940.10; ENST00000461253.1; ENST00000447185.5; ENST00000361559.8; ENST00000481649.1; ENST00000471619.5; ENST00000452717.1; ENST00000445941.5; ENST00000360351.8; ENST00000482864.5; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508868 | ||
| mod ID: M6ASITE049816 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692785-209692786:+ | [8] | |
| Sequence | CTCAGCCAGAGACAACTAAAACTTACCCTGATAAAAAGGAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Brain; hNPCs; fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000445941.5; ENST00000392194.5; ENST00000447185.5; ENST00000452717.1; ENST00000199940.10; ENST00000471619.5; ENST00000461253.1; ENST00000361559.8; ENST00000482864.5; ENST00000481649.1; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508869 | ||
| mod ID: M6ASITE049817 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692804-209692805:+ | [6] | |
| Sequence | AACTTACCCTGATAAAAAGGACATGCAAGGCACGGAAGAAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | brain; Brain; hNPCs; fibroblasts; iSLK | ||
| Seq Type List | m6A-REF-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000482864.5; ENST00000199940.10; ENST00000461253.1; ENST00000361559.8; ENST00000445941.5; ENST00000447185.5; ENST00000471619.5; ENST00000392194.5; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508870 | ||
| mod ID: M6ASITE049818 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692876-209692877:+ | [8] | |
| Sequence | TCTTGTTGCCAGCCTGGAAGACATGAAACAGAAGACAGAAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Brain; hNPCs; fibroblasts; Huh7; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000445941.5; ENST00000447185.5; ENST00000392194.5; ENST00000361559.8; ENST00000452717.1; ENST00000482864.5; ENST00000471619.5; ENST00000199940.10; ENST00000360351.8; ENST00000461253.1 | ||
| External Link | RMBase: m6A_site_508871 | ||
| mod ID: M6ASITE049819 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692883-209692884:+ | [8] | |
| Sequence | GCCAGCCTGGAAGACATGAAACAGAAGACAGAACCAAGCCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Brain; hNPCs; fibroblasts; Huh7; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000461253.1; ENST00000361559.8; ENST00000445941.5; ENST00000482864.5; ENST00000360351.8; ENST00000452717.1; ENST00000199940.10; ENST00000471619.5; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508872 | ||
| mod ID: M6ASITE049820 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692890-209692891:+ | [8] | |
| Sequence | TGGAAGACATGAAACAGAAGACAGAACCAAGCCTTGTAGTA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Brain; hNPCs; fibroblasts; Huh7; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000461253.1; ENST00000361559.8; ENST00000445941.5; ENST00000482864.5; ENST00000447185.5; ENST00000199940.10; ENST00000471619.5; ENST00000452717.1; ENST00000360351.8; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508873 | ||
| mod ID: M6ASITE049821 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692895-209692896:+ | [5] | |
| Sequence | GACATGAAACAGAAGACAGAACCAAGCCTTGTAGTACCTGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000199940.10; ENST00000445941.5; ENST00000461253.1; ENST00000447185.5; ENST00000360351.8; ENST00000471619.5; ENST00000482864.5; ENST00000452717.1; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508874 | ||
| mod ID: M6ASITE049822 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692952-209692953:+ | [5] | |
| Sequence | GAGCCTCCAACTCCAAAAGAACAAAAGGACTGGTTCATCGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000199940.10; ENST00000447185.5; ENST00000461253.1; ENST00000392194.5; ENST00000452717.1; ENST00000445941.5; ENST00000482864.5; ENST00000361559.8; ENST00000360351.8; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508875 | ||
| mod ID: M6ASITE049823 | Click to Show/Hide the Full List | ||
| mod site | chr2:209692960-209692961:+ | [5] | |
| Sequence | AACTCCAAAAGAACAAAAGGACTGGTTCATCGAAATGCCAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000471619.5; ENST00000447185.5; ENST00000461253.1; ENST00000360351.8; ENST00000392194.5; ENST00000445941.5; ENST00000482864.5; ENST00000452717.1; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508876 | ||
| mod ID: M6ASITE049824 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693090-209693091:+ | [6] | |
| Sequence | ATCCCAAAATGGGAAGGGAAACAGTTTGATTCTCCCATGCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000199940.10; ENST00000447185.5; ENST00000360351.8; ENST00000445941.5; ENST00000392194.5; ENST00000471619.5; ENST00000482864.5; ENST00000361559.8; ENST00000452717.1; ENST00000461253.1 | ||
| External Link | RMBase: m6A_site_508877 | ||
| mod ID: M6ASITE049825 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693294-209693295:+ | [5] | |
| Sequence | GAAGAGCCCCATGAGGCTAAACCTGACAAAATGGCAGAAGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000199940.10; ENST00000445941.5; ENST00000361559.8; ENST00000360351.8; ENST00000392194.5; ENST00000471619.5; ENST00000452717.1; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508878 | ||
| mod ID: M6ASITE049826 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693372-209693373:+ | [5] | |
| Sequence | CACATTCCAGTTGTAGAAGAACATGTTATGGGGAAAGTTTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000452717.1; ENST00000199940.10; ENST00000392194.5; ENST00000445941.5; ENST00000361559.8; ENST00000482864.5; ENST00000360351.8; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508879 | ||
| mod ID: M6ASITE049827 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693424-209693425:+ | [5] | |
| Sequence | AGGAGGCCATAAATCAAGAGACTGTGCAGCAAAGGGATACT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000360351.8; ENST00000482864.5; ENST00000392194.5; ENST00000447185.5; ENST00000471619.5; ENST00000445941.5; ENST00000452717.1; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508880 | ||
| mod ID: M6ASITE049828 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693459-209693460:+ | [5] | |
| Sequence | GATACTTTCACCCCCAGTGGACAGGAACCTATACTTACTGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000445941.5; ENST00000361559.8; ENST00000199940.10; ENST00000392194.5; ENST00000482864.5; ENST00000452717.1; ENST00000447185.5; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508881 | ||
| mod ID: M6ASITE049829 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693465-209693466:+ | [5] | |
| Sequence | TTCACCCCCAGTGGACAGGAACCTATACTTACTGAAAAGGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000445941.5; ENST00000392194.5; ENST00000199940.10; ENST00000360351.8; ENST00000471619.5; ENST00000447185.5; ENST00000482864.5; ENST00000452717.1 | ||
| External Link | RMBase: m6A_site_508882 | ||
| mod ID: M6ASITE049830 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693487-209693488:+ | [5] | |
| Sequence | CTATACTTACTGAAAAGGAAACTGAGCTGAAGCTTGAAGAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000360351.8; ENST00000471619.5; ENST00000482864.5; ENST00000447185.5; ENST00000199940.10; ENST00000452717.1; ENST00000392194.5; ENST00000445941.5; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508883 | ||
| mod ID: M6ASITE049831 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693511-209693512:+ | [5] | |
| Sequence | AGCTGAAGCTTGAAGAAAAAACCACCATTTCTGACAAAGAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000471619.5; ENST00000360351.8; ENST00000199940.10; ENST00000361559.8; ENST00000452717.1; ENST00000447185.5; ENST00000392194.5; ENST00000445941.5 | ||
| External Link | RMBase: m6A_site_508884 | ||
| mod ID: M6ASITE049832 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693552-209693553:+ | [5] | |
| Sequence | GCTGTGCCAAAAGAGAGTAAACCCCCAAAACCTGCAGATGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000445941.5; ENST00000471619.5; ENST00000482864.5; ENST00000361559.8; ENST00000452717.1; ENST00000199940.10; ENST00000447185.5; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508885 | ||
| mod ID: M6ASITE049833 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693561-209693562:+ | [5] | |
| Sequence | AAAGAGAGTAAACCCCCAAAACCTGCAGATGAAGAAATAGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000471619.5; ENST00000392194.5; ENST00000360351.8; ENST00000445941.5; ENST00000447185.5; ENST00000482864.5; ENST00000361559.8; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508886 | ||
| mod ID: M6ASITE049834 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693592-209693593:+ | [5] | |
| Sequence | AAGAAATAGGCATAATTCAGACCTCCACAGAGCACACTTTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000360351.8; ENST00000452717.1; ENST00000482864.5; ENST00000199940.10; ENST00000361559.8; ENST00000445941.5; ENST00000471619.5; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508887 | ||
| mod ID: M6ASITE049835 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693618-209693619:+ | [5] | |
| Sequence | ACAGAGCACACTTTCTCAGAACAGAAAGACCAAGAGCCTAC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000447185.5; ENST00000452717.1; ENST00000445941.5; ENST00000392194.5; ENST00000482864.5; ENST00000361559.8; ENST00000199940.10; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508888 | ||
| mod ID: M6ASITE049836 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693626-209693627:+ | [5] | |
| Sequence | CACTTTCTCAGAACAGAAAGACCAAGAGCCTACCACAGATA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000471619.5; ENST00000361559.8; ENST00000447185.5; ENST00000199940.10; ENST00000360351.8; ENST00000392194.5; ENST00000452717.1 | ||
| External Link | RMBase: m6A_site_508889 | ||
| mod ID: M6ASITE049837 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693640-209693641:+ | [6] | |
| Sequence | AGAAAGACCAAGAGCCTACCACAGATATGTTGAAACAGGAC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000360351.8; ENST00000392194.5; ENST00000471619.5; ENST00000452717.1; ENST00000199940.10; ENST00000361559.8; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508890 | ||
| mod ID: M6ASITE049838 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693654-209693655:+ | [5] | |
| Sequence | CCTACCACAGATATGTTGAAACAGGACTCGTTCCCTGTAAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000199940.10; ENST00000452717.1; ENST00000360351.8; ENST00000361559.8; ENST00000482864.5; ENST00000447185.5; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508891 | ||
| mod ID: M6ASITE049839 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693659-209693660:+ | [5] | |
| Sequence | CACAGATATGTTGAAACAGGACTCGTTCCCTGTAAGTTTGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000199940.10; ENST00000392194.5; ENST00000447185.5; ENST00000482864.5; ENST00000471619.5; ENST00000361559.8; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508892 | ||
| mod ID: M6ASITE049840 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693715-209693716:+ | [9] | |
| Sequence | ATTCAGCCATGACCTCTAAAACACTGGAGAAAGCCATGACC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T; hNPCs; fibroblasts; Huh7; iSLK; MSC; TIME | ||
| Seq Type List | MAZTER-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000199940.10; ENST00000452717.1; ENST00000360351.8; ENST00000471619.5; ENST00000447185.5; ENST00000361559.8; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508893 | ||
| mod ID: M6ASITE049841 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693738-209693739:+ | [5] | |
| Sequence | CTGGAGAAAGCCATGACCGAACCATCTGCATTAATTGAAAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000471619.5; ENST00000482864.5; ENST00000199940.10; ENST00000392194.5; ENST00000361559.8; ENST00000360351.8; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508894 | ||
| mod ID: M6ASITE049842 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693774-209693775:+ | [5] | |
| Sequence | GAAAAGAGCTCAATTCAGGAACTTTTTGAAATGAGAGTTGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000199940.10; ENST00000392194.5; ENST00000452717.1; ENST00000482864.5; ENST00000360351.8; ENST00000447185.5; ENST00000361559.8; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508895 | ||
| mod ID: M6ASITE049843 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693797-209693798:+ | [9] | |
| Sequence | TTTTGAAATGAGAGTTGATGACAAAGATAAGATTGAAGGAG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000360351.8; ENST00000471619.5; ENST00000452717.1; ENST00000447185.5; ENST00000392194.5; ENST00000482864.5; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508896 | ||
| mod ID: M6ASITE049844 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693892-209693893:+ | [8] | |
| Sequence | GAATGTCCAAGTACTTTGAAACATCTGCCTTGAAAGAAGAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Brain; hNPCs; hESCs; fibroblasts; Huh7; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000360351.8; ENST00000452717.1; ENST00000199940.10; ENST00000471619.5; ENST00000447185.5; ENST00000392194.5; ENST00000482864.5 | ||
| External Link | RMBase: m6A_site_508897 | ||
| mod ID: M6ASITE049845 | Click to Show/Hide the Full List | ||
| mod site | chr2:209693951-209693952:+ | [5] | |
| Sequence | CCAGGCAGTGATTACTATGAACTGAGTGACACTAGAGAAAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | hNPCs; hESCs; fibroblasts; Huh7; GSC-11; MSC; TIME; iSLK; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000199940.10; ENST00000361559.8; ENST00000392194.5; ENST00000452717.1; ENST00000360351.8; ENST00000482864.5; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508898 | ||
| mod ID: M6ASITE049846 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694033-209694034:+ | [5] | |
| Sequence | ATGGTGACAAGGAGTTTCAAACAGGAAAAGAATCCCAGCCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | fibroblasts; Huh7; GSC-11; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000447185.5; ENST00000471619.5; ENST00000482864.5; ENST00000199940.10; ENST00000452717.1; ENST00000361559.8; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508899 | ||
| mod ID: M6ASITE049847 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694122-209694123:+ | [4] | |
| Sequence | CCATCAGATTTACCTGAAGAACCCAGTTCTCCTCAAGAAAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | Huh7; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000360351.8; ENST00000392194.5; ENST00000452717.1; ENST00000361559.8; ENST00000482864.5; ENST00000199940.10; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508900 | ||
| mod ID: M6ASITE049848 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694233-209694234:+ | [5] | |
| Sequence | ACCCTTAGCAGGAGTTTAGGACTTGGTGGTAGGTCTGCAAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000447185.5; ENST00000452717.1; ENST00000199940.10; ENST00000361559.8; ENST00000482864.5; ENST00000392194.5; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508901 | ||
| mod ID: M6ASITE049849 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694257-209694258:+ | [5] | |
| Sequence | GGTGGTAGGTCTGCAATAGAACAAAGAAGCATGTCAATCAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | fibroblasts; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000199940.10; ENST00000471619.5; ENST00000447185.5; ENST00000361559.8; ENST00000482864.5; ENST00000392194.5; ENST00000452717.1; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508902 | ||
| mod ID: M6ASITE049850 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694332-209694333:+ | [10] | |
| Sequence | GGATTTAACTTTGGTCGGGGACATGATCTTTCTCCTCTGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | iSLK; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000482864.5; ENST00000452717.1; ENST00000447185.5; ENST00000360351.8; ENST00000392194.5; ENST00000471619.5; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508903 | ||
| mod ID: M6ASITE049851 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694730-209694731:+ | [5] | |
| Sequence | GCCCCCGGTAACTGATGAAAACCATGTCATTGTAAAAACGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360351.8; ENST00000471619.5; ENST00000452717.1; ENST00000482864.5; ENST00000199940.10; ENST00000392194.5; ENST00000361559.8; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508904 | ||
| mod ID: M6ASITE049852 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694751-209694752:+ | [5] | |
| Sequence | CCATGTCATTGTAAAAACGGACAGTCAGCTCGAAGACCTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000482864.5; ENST00000199940.10; ENST00000447185.5; ENST00000361559.8; ENST00000360351.8; ENST00000392194.5; ENST00000452717.1 | ||
| External Link | RMBase: m6A_site_508905 | ||
| mod ID: M6ASITE049853 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694766-209694767:+ | [5] | |
| Sequence | AACGGACAGTCAGCTCGAAGACCTGGGCTACTGTGTGTTCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000199940.10; ENST00000471619.5; ENST00000482864.5; ENST00000361559.8; ENST00000447185.5; ENST00000392194.5; ENST00000360351.8; ENST00000452717.1 | ||
| External Link | RMBase: m6A_site_508906 | ||
| mod ID: M6ASITE049854 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694823-209694824:+ | [5] | |
| Sequence | ATTGCCATCACCTGTTCAAGACAGTGAGAATTTATCAGGGG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000360351.8; ENST00000471619.5; ENST00000482864.5; ENST00000447185.5; ENST00000392194.5; ENST00000199940.10; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508907 | ||
| mod ID: M6ASITE049855 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694901-209694902:+ | [5] | |
| Sequence | TCGAAGAGATTTGGCCACAGACCTTTCACTGATTGAAGTGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000392194.5; ENST00000452717.1; ENST00000199940.10; ENST00000482864.5; ENST00000471619.5; ENST00000360351.8; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508908 | ||
| mod ID: M6ASITE049856 | Click to Show/Hide the Full List | ||
| mod site | chr2:209694923-209694924:+ | [5] | |
| Sequence | CTTTCACTGATTGAAGTGAAACTGGCAGCAGCCGGAAGAGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360351.8; ENST00000392194.5; ENST00000452717.1; ENST00000482864.5; ENST00000471619.5; ENST00000447185.5; ENST00000199940.10; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508909 | ||
| mod ID: M6ASITE049857 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695004-209695005:+ | [5] | |
| Sequence | ATCTCTGGTGACAAATCAGGACTGAGTAAGGAGTTTGACCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000392194.5; ENST00000361559.8; ENST00000452717.1; ENST00000360351.8; ENST00000482864.5; ENST00000447185.5; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508910 | ||
| mod ID: M6ASITE049858 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695076-209695077:+ | [5] | |
| Sequence | GTACTAGAAAAGAGTGAAGAACATGCTGATTCAAAAGAACA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000471619.5; ENST00000447185.5; ENST00000360351.8; ENST00000392194.5; ENST00000199940.10; ENST00000361559.8; ENST00000482864.5 | ||
| External Link | RMBase: m6A_site_508911 | ||
| mod ID: M6ASITE049859 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695094-209695095:+ | [5] | |
| Sequence | GAACATGCTGATTCAAAAGAACATGCCAAGAAAACTGAAGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000199940.10; ENST00000452717.1; ENST00000447185.5; ENST00000482864.5; ENST00000471619.5; ENST00000360351.8; ENST00000361559.8; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508912 | ||
| mod ID: M6ASITE049860 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695107-209695108:+ | [5] | |
| Sequence | CAAAAGAACATGCCAAGAAAACTGAAGAGGCTGGTGATGAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000361559.8; ENST00000452717.1; ENST00000482864.5; ENST00000199940.10; ENST00000360351.8; ENST00000471619.5; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508913 | ||
| mod ID: M6ASITE049861 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695134-209695135:+ | [5] | |
| Sequence | AGGCTGGTGATGAAATAGAAACATTCGGATTAGGAGTAACC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000360351.8; ENST00000392194.5; ENST00000482864.5; ENST00000199940.10; ENST00000452717.1; ENST00000361559.8; ENST00000447185.5; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508914 | ||
| mod ID: M6ASITE049862 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695256-209695257:+ | [5] | |
| Sequence | CCAGAGATAGCTGAGGTAGAACCATCCAAAAAGGTGGAACA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000471619.5; ENST00000361559.8; ENST00000392194.5; ENST00000447185.5; ENST00000360351.8; ENST00000199940.10; ENST00000482864.5 | ||
| External Link | RMBase: m6A_site_508915 | ||
| mod ID: M6ASITE049863 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695274-209695275:+ | [5] | |
| Sequence | GAACCATCCAAAAAGGTGGAACAAGGTCTGGATTTTGCTGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000392194.5; ENST00000482864.5; ENST00000452717.1; ENST00000360351.8; ENST00000447185.5; ENST00000199940.10; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508916 | ||
| mod ID: M6ASITE049864 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695331-209695332:+ | [5] | |
| Sequence | GTTAAAATTAGTGACTTTGGACAGATGGCTTCAGGGCTAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000360351.8; ENST00000471619.5; ENST00000482864.5; ENST00000199940.10; ENST00000361559.8; ENST00000452717.1; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508917 | ||
| mod ID: M6ASITE049865 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695351-209695352:+ | [5] | |
| Sequence | ACAGATGGCTTCAGGGCTAAACATAGATGATAGAAGGGCAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000360351.8; ENST00000447185.5; ENST00000392194.5; ENST00000482864.5; ENST00000199940.10; ENST00000361559.8; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508918 | ||
| mod ID: M6ASITE049866 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695382-209695383:+ | [5] | |
| Sequence | AGAAGGGCAACAGAGCTAAAACTTGAGGCTACACAGGACAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000471619.5; ENST00000452717.1; ENST00000482864.5; ENST00000360351.8; ENST00000361559.8; ENST00000392194.5; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508919 | ||
| mod ID: M6ASITE049867 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695399-209695400:+ | [5] | |
| Sequence | AAAACTTGAGGCTACACAGGACATGACCCCCTCATCCAAAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000199940.10; ENST00000452717.1; ENST00000360351.8; ENST00000392194.5; ENST00000361559.8; ENST00000447185.5; ENST00000471619.5 | ||
| External Link | RMBase: m6A_site_508920 | ||
| mod ID: M6ASITE049868 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695853-209695854:+ | [5] | |
| Sequence | CATGAAACGATCGTATCTGAACCAGCAGAGATTCAGAGTGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000471619.5; ENST00000360351.8; ENST00000482864.5; ENST00000199940.10; ENST00000452717.1; ENST00000447185.5; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508921 | ||
| mod ID: M6ASITE049869 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695910-209695911:+ | [5] | |
| Sequence | GCCCAGGGAGAATATGATAAACTGCTCTTCCGCTCAGACAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hNPCs; Huh7; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000392194.5; ENST00000447185.5; ENST00000361559.8; ENST00000452717.1; ENST00000199940.10; ENST00000482864.5; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508922 | ||
| mod ID: M6ASITE049870 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695927-209695928:+ | [4] | |
| Sequence | TAAACTGCTCTTCCGCTCAGACACCCTTCAGATAACTGACC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7; iSLK; TIME; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000452717.1; ENST00000471619.5; ENST00000392194.5; ENST00000199940.10; ENST00000360351.8; ENST00000482864.5; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508923 | ||
| mod ID: M6ASITE049871 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695983-209695984:+ | [10] | |
| Sequence | CCAGGGAGGAATTTGTGGAGACCTGCCCAAGTGAACACAAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | iSLK; MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000199940.10; ENST00000361559.8; ENST00000392194.5; ENST00000471619.5; ENST00000360351.8; ENST00000482864.5; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508924 | ||
| mod ID: M6ASITE049872 | Click to Show/Hide the Full List | ||
| mod site | chr2:209695997-209695998:+ | [10] | |
| Sequence | GTGGAGACCTGCCCAAGTGAACACAAAGGAGTGATTGAGTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | iSLK; MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000452717.1; ENST00000482864.5; ENST00000447185.5; ENST00000361559.8; ENST00000360351.8; ENST00000471619.5; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508925 | ||
| mod ID: M6ASITE049873 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696058-209696059:+ | [10] | |
| Sequence | ATTTCATCACTGTAGTGCAAACCACAACTGATGAAGGGGAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | iSLK; MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000471619.5; ENST00000360351.8; ENST00000392194.5; ENST00000199940.10; ENST00000482864.5; ENST00000452717.1; ENST00000447185.5 | ||
| External Link | RMBase: m6A_site_508926 | ||
| mod ID: M6ASITE049874 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696135-209696136:+ | [5] | |
| Sequence | CAGCCTGAGGTGGAAAGGAGACCATCTCCTCATGATGAAGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000452717.1; ENST00000447185.5; ENST00000360351.8; ENST00000199940.10; ENST00000471619.5; ENST00000361559.8; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508927 | ||
| mod ID: M6ASITE049875 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696195-209696196:+ | [5] | |
| Sequence | GCAGCTGAAGCCCAGGCAGAACCCAAAGATGGTTCCCCAGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000392194.5; ENST00000482864.5; ENST00000199940.10; ENST00000471619.5; ENST00000361559.8; ENST00000360351.8; ENST00000452717.1 | ||
| External Link | RMBase: m6A_site_508928 | ||
| mod ID: M6ASITE049876 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696265-209696266:+ | [5] | |
| Sequence | TTGCACTTTCTGAATATAAGACAGAAACCTATGACGATTAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000360351.8; ENST00000361559.8; ENST00000447185.5; ENST00000199940.10; ENST00000471619.5; ENST00000482864.5; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508929 | ||
| mod ID: M6ASITE049877 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696271-209696272:+ | [5] | |
| Sequence | TTTCTGAATATAAGACAGAAACCTATGACGATTACAAAGAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000452717.1; ENST00000447185.5; ENST00000360351.8; ENST00000471619.5; ENST00000392194.5; ENST00000199940.10; ENST00000482864.5 | ||
| External Link | RMBase: m6A_site_508930 | ||
| mod ID: M6ASITE049878 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696295-209696296:+ | [5] | |
| Sequence | ATGACGATTACAAAGATGAGACCACCATTGACGACTCCATC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471619.5; ENST00000447185.5; ENST00000482864.5; ENST00000452717.1; ENST00000360351.8; ENST00000361559.8; ENST00000199940.10; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508931 | ||
| mod ID: M6ASITE049879 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696341-209696342:+ | [5] | |
| Sequence | CGCTGACAGCCTCTGGGTGGACACTCAAGGTGTGCATTATT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000475600.5; ENST00000392194.5; ENST00000199940.10; ENST00000482864.5; ENST00000361559.8; ENST00000447185.5; ENST00000452717.1; ENST00000471619.5; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508932 | ||
| mod ID: M6ASITE049880 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696566-209696567:+ | [5] | |
| Sequence | GATAGGAGCATCATGACAGAACAGTTAGAAACTATTCCTAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000392194.5; ENST00000199940.10; ENST00000360351.8; ENST00000482864.5; ENST00000361559.8; ENST00000471619.5; ENST00000452717.1; ENST00000475600.5 | ||
| External Link | RMBase: m6A_site_508933 | ||
| mod ID: M6ASITE049881 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696576-209696577:+ | [5] | |
| Sequence | TCATGACAGAACAGTTAGAAACTATTCCTAAAGAGGAGAAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hNPCs; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392194.5; ENST00000447185.5; ENST00000471619.5; ENST00000361559.8; ENST00000475600.5; ENST00000360351.8; ENST00000199940.10; ENST00000482864.5; ENST00000452717.1 | ||
| External Link | RMBase: m6A_site_508934 | ||
| mod ID: M6ASITE049882 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696632-209696633:+ | [5] | |
| Sequence | CGGAGATCATCTCTTGAGAAACATAGAAAAGAAAAGCCTTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482864.5; ENST00000199940.10; ENST00000392194.5; ENST00000471619.5; ENST00000452717.1; ENST00000475600.5; ENST00000360351.8; ENST00000447185.5; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508935 | ||
| mod ID: M6ASITE049883 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696657-209696658:+ | [5] | |
| Sequence | GAAAAGAAAAGCCTTTTAAAACCGGGAGAGGCAGAATTTCC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000452717.1; ENST00000471619.5; ENST00000392194.5; ENST00000199940.10; ENST00000475600.5; ENST00000482864.5; ENST00000447185.5; ENST00000361559.8; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508936 | ||
| mod ID: M6ASITE049884 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696707-209696708:+ | [5] | |
| Sequence | AGAAAAGTAGCTAAAAAGGAACCTAGCACAGTCTCCAGAGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | hNPCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000475600.5; ENST00000392194.5; ENST00000447185.5; ENST00000360351.8; ENST00000482864.5; ENST00000199940.10; ENST00000361559.8; ENST00000471619.5; ENST00000452717.1 | ||
| External Link | RMBase: m6A_site_508937 | ||
| mod ID: M6ASITE049885 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696935-209696936:+ | [5] | |
| Sequence | GCAGTTTATAAGAAGGCTGAACTTGCTAAAAAAACAGAAGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000447185.5; ENST00000471619.5; ENST00000475600.5; ENST00000361559.8; ENST00000452717.1; ENST00000360351.8; ENST00000392194.5; ENST00000199940.10 | ||
| External Link | RMBase: m6A_site_508938 | ||
| mod ID: M6ASITE049886 | Click to Show/Hide the Full List | ||
| mod site | chr2:209696948-209696949:+ | [6] | |
| Sequence | AGGCTGAACTTGCTAAAAAAACAGAAGTTCAGGCCCACTCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000360351.8; ENST00000199940.10; ENST00000447185.5; ENST00000361559.8; ENST00000475600.5; ENST00000452717.1; ENST00000471619.5; ENST00000392194.5 | ||
| External Link | RMBase: m6A_site_508939 | ||
| mod ID: M6ASITE049887 | Click to Show/Hide the Full List | ||
| mod site | chr2:209700327-209700328:+ | [9] | |
| Sequence | TGTATTTAAACAGGCAAAGGACAAAGTCTCTGTGAGTAAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000475600.5; ENST00000392194.5; ENST00000447185.5; ENST00000471619.5; ENST00000452717.1; ENST00000199940.10; ENST00000361559.8; ENST00000360351.8 | ||
| External Link | RMBase: m6A_site_508940 | ||
| mod ID: M6ASITE049888 | Click to Show/Hide the Full List | ||
| mod site | chr2:209710035-209710036:+ | [4] | |
| Sequence | GCACACCAGGCACTCCTGGAACCCCTAGCTATCCCAGGACC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000361559.8; ENST00000471619.5; ENST00000360351.8; ENST00000199940.10; ENST00000447185.5; ENST00000473543.1; ENST00000392194.5; ENST00000478233.1; ENST00000475600.5; ENST00000464007.1 | ||
| External Link | RMBase: m6A_site_508941 | ||
| mod ID: M6ASITE049889 | Click to Show/Hide the Full List | ||
| mod site | chr2:209710053-209710054:+ | [4] | |
| Sequence | GAACCCCTAGCTATCCCAGGACCCCTCACACACCAGGAACC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000473543.1; ENST00000447185.5; ENST00000361559.8; ENST00000471619.5; ENST00000475600.5; ENST00000199940.10; ENST00000464007.1; ENST00000360351.8; ENST00000392194.5; ENST00000478233.1 | ||
| External Link | RMBase: m6A_site_508942 | ||
| mod ID: M6ASITE049890 | Click to Show/Hide the Full List | ||
| mod site | chr2:209710071-209710072:+ | [4] | |
| Sequence | GGACCCCTCACACACCAGGAACCCCCAAGTCTGCCATCTTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000475600.5; ENST00000392194.5; ENST00000447185.5; ENST00000471619.5; ENST00000199940.10; ENST00000361559.8; ENST00000473543.1; ENST00000360351.8; ENST00000464007.1; ENST00000478233.1 | ||
| External Link | RMBase: m6A_site_508943 | ||
| mod ID: M6ASITE049891 | Click to Show/Hide the Full List | ||
| mod site | chr2:209710186-209710187:+ | [4] | |
| Sequence | TATTAACCAACCACTGCCAGACCTGAAGAATGTCAAATCCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000475600.5; ENST00000447185.5; ENST00000392194.5; ENST00000199940.10; ENST00000478233.1; ENST00000360351.8; ENST00000471619.5; ENST00000361559.8; ENST00000473543.1 | ||
| External Link | RMBase: m6A_site_508944 | ||
| mod ID: M6ASITE049892 | Click to Show/Hide the Full List | ||
| mod site | chr2:209710222-209710223:+ | [4] | |
| Sequence | ATCCAAAATCGGATCAACAGACAACATCAAATACCAGCCTA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000478233.1; ENST00000475600.5; ENST00000392194.5; ENST00000199940.10; ENST00000360351.8; ENST00000473543.1; ENST00000447185.5; ENST00000471619.5; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508945 | ||
| mod ID: M6ASITE049893 | Click to Show/Hide the Full List | ||
| mod site | chr2:209710269-209710270:+ | [4] | |
| Sequence | GGCAGGTAAGAATTGCATGAACACATATTTGCTGCCAGAAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000478233.1; ENST00000392194.5; ENST00000199940.10; ENST00000360351.8; ENST00000447185.5; ENST00000475600.5; ENST00000473543.1; ENST00000361559.8 | ||
| External Link | RMBase: m6A_site_508946 | ||
References

