m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00589)
Target Name Epithelial splicing regulatory protein 2 (ESRP2)
Synonyms
RNA-binding motif protein 35B; RNA-binding protein 35B
    Click to Show/Hide
Gene Name ESRP2
Chromosomal Location 16q22.1
Family ESRP family
Function
mRNA splicing factor that regulates the formation of epithelial cell-specific isoforms. Specifically regulates the expression of FGFR2-IIIb, an epithelial cell-specific isoform of FGFR2. Also regulates the splicing of CD44, CTNND1, ENAH, 3 transcripts that undergo changes in splicing during the epithelial-to-mesenchymal transition (EMT). Acts by directly binding specific sequences in mRNAs. Binds the GU-rich sequence motifs in the ISE/ISS-3, a cis-element regulatory region present in the mRNA of FGFR2.
    Click to Show/Hide
Gene ID 80004
Uniprot ID
ESRP2_HUMAN
HGNC ID
HGNC:26152
KEGG ID
hsa:80004
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ESRP2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The expression of METTL14 was negatively correlated to the prognosis, stage, and ccRCC tumor grade. Lnc-LSG1 could be regulated by METTL14. Lnc-LSG1 can directly bind to Epithelial splicing regulatory protein 2 (ESRP2) protein and promote ESRP2 degradation via facilitating ESRP2 ubiquitination.
Target Regulation Up regulation
Responsed Disease Renal cell carcinoma of kidney ICD-11: 2C90.0
 Disease Info 
Pathway Response Ubiquitin mediated proteolysis hsa04120
Cell Process Ubiquitination
In-vitro Model OS-RC-2 Clear cell renal cell carcinoma Homo sapiens CVCL_1626
Caki-1 Clear cell renal cell carcinoma Homo sapiens CVCL_0234
786-O Renal cell carcinoma Homo sapiens CVCL_1051
In-vivo Model For the xenograft tumor model, approximately 1 × 106 ccRCC cells suspended in 100 uL PBS were subcutaneously inoculated in the right flank of 5-week-old BALB/c nude mice. For the ccRCC orthotopic implantation model, approximately 1 × 106 ccRCC cells suspended in 30 uL Matrigel were injected under the renal capsule of 5-week-old BALB/c nude mice. After 6 weeks, the anesthetized mice were intraperitoneally injected with D-luciferin (Yeason) and imaged using an in vivo imaging system to detect tumor growth and metastasis. For the lung metastasis model, approximately 5 × 105 ccRCC cells suspended in PBS were injected into the tail vein of 5-week-old mice. After 6-8 weeks, mice were anesthetized and lung metastasis was imaged as above.
Renal cell carcinoma [ICD-11: 2C90]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary The expression of METTL14 was negatively correlated to the prognosis, stage, and ccRCC tumor grade. Lnc-LSG1 could be regulated by METTL14. Lnc-LSG1 can directly bind to Epithelial splicing regulatory protein 2 (ESRP2) protein and promote ESRP2 degradation via facilitating ESRP2 ubiquitination.
Responsed Disease Renal cell carcinoma of kidney [ICD-11: 2C90.0]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Ubiquitin mediated proteolysis hsa04120
Cell Process Ubiquitination
In-vitro Model OS-RC-2 Clear cell renal cell carcinoma Homo sapiens CVCL_1626
Caki-1 Clear cell renal cell carcinoma Homo sapiens CVCL_0234
786-O Renal cell carcinoma Homo sapiens CVCL_1051
In-vivo Model For the xenograft tumor model, approximately 1 × 106 ccRCC cells suspended in 100 uL PBS were subcutaneously inoculated in the right flank of 5-week-old BALB/c nude mice. For the ccRCC orthotopic implantation model, approximately 1 × 106 ccRCC cells suspended in 30 uL Matrigel were injected under the renal capsule of 5-week-old BALB/c nude mice. After 6 weeks, the anesthetized mice were intraperitoneally injected with D-luciferin (Yeason) and imaged using an in vivo imaging system to detect tumor growth and metastasis. For the lung metastasis model, approximately 5 × 105 ccRCC cells suspended in PBS were injected into the tail vein of 5-week-old mice. After 6-8 weeks, mice were anesthetized and lung metastasis was imaged as above.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00589)
Epithelial splicing regulatory protein 2 (ESRP2)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000214 Click to Show/Hide the Full List
mod site chr16:68229409-68229410:-
Sequence ATGGTACAGAACTGAAGCCTCGGAAGCAATTTGGAACTCGA
Cell/Tissue List DLD1
Seq Type List acRIP-seq
Transcript ID List ENST00000566774.1; ENST00000251366.7; ENST00000473183.6; ENST00000565858.5
External Link RMBase: ac4C_site_709
5-methylcytidine (m5C)
In total 6 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000747 Click to Show/Hide the Full List
mod site chr16:68229554-68229555:- [2]
Sequence ATTAGGGGGCAGTAGGCCCCCACACAAAACCTTCAGGCTTG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000565858.5; ENST00000251366.7; ENST00000566774.1; ENST00000473183.6
External Link RMBase: m5C_site_16415
mod ID: M5CSITE000748 Click to Show/Hide the Full List
mod site chr16:68229555-68229556:- [2]
Sequence CATTAGGGGGCAGTAGGCCCCCACACAAAACCTTCAGGCTT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000473183.6; ENST00000251366.7; ENST00000566774.1; ENST00000565858.5
External Link RMBase: m5C_site_16416
mod ID: M5CSITE000749 Click to Show/Hide the Full List
mod site chr16:68229556-68229557:- [2]
Sequence ACATTAGGGGGCAGTAGGCCCCCACACAAAACCTTCAGGCT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000251366.7; ENST00000473183.6; ENST00000566774.1; ENST00000565858.5
External Link RMBase: m5C_site_16417
mod ID: M5CSITE000750 Click to Show/Hide the Full List
mod site chr16:68229557-68229558:- [2]
Sequence GACATTAGGGGGCAGTAGGCCCCCACACAAAACCTTCAGGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000566774.1; ENST00000473183.6; ENST00000251366.7; ENST00000565858.5
External Link RMBase: m5C_site_16418
mod ID: M5CSITE000751 Click to Show/Hide the Full List
mod site chr16:68229558-68229559:- [2]
Sequence AGACATTAGGGGGCAGTAGGCCCCCACACAAAACCTTCAGG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000473183.6; ENST00000566774.1; ENST00000251366.7; ENST00000565858.5
External Link RMBase: m5C_site_16419
mod ID: M5CSITE000752 Click to Show/Hide the Full List
mod site chr16:68229565-68229566:- [3]
Sequence CACCAGAAGACATTAGGGGGCAGTAGGCCCCCACACAAAAC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000251366.7; ENST00000566774.1; ENST00000565858.5; ENST00000473183.6
External Link RMBase: m5C_site_16420
N6-methyladenosine (m6A)
In total 41 m6A sequence/site(s) in this target gene
mod ID: M6ASITE027895 Click to Show/Hide the Full List
mod site chr16:68229123-68229124:- [4]
Sequence AAAATACAAAATGTACAAGAACACACAATTCCAAGTGCTGT
Motif Score 2.951386905
Cell/Tissue List HEK293T; HeLa; HepG2; Huh7
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000251366.7; ENST00000571197.1; ENST00000565858.5
External Link RMBase: m6A_site_327142
mod ID: M6ASITE027896 Click to Show/Hide the Full List
mod site chr16:68229219-68229220:- [5]
Sequence TTTATTATTTCAGCACTAAAACTGAGGAGCCTCAACTGCTG
Motif Score 2.627720238
Cell/Tissue List HepG2; HEK293T; HeLa; H1A; H1B; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000251366.7; ENST00000565858.5; ENST00000473183.6
External Link RMBase: m6A_site_327145
mod ID: M6ASITE027897 Click to Show/Hide the Full List
mod site chr16:68229270-68229271:- [5]
Sequence CCAGGCGGAGGAACACTCAGACAGATTAAGGATACTGTTGA
Motif Score 2.897386905
Cell/Tissue List HepG2; HEK293T; HeLa; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565858.5; ENST00000473183.6; ENST00000251366.7
External Link RMBase: m6A_site_327148
mod ID: M6ASITE027898 Click to Show/Hide the Full List
mod site chr16:68229278-68229279:- [5]
Sequence CACCAACCCCAGGCGGAGGAACACTCAGACAGATTAAGGAT
Motif Score 2.951386905
Cell/Tissue List HepG2; HEK293T; HeLa; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565858.5; ENST00000473183.6; ENST00000251366.7
External Link RMBase: m6A_site_327149
mod ID: M6ASITE027899 Click to Show/Hide the Full List
mod site chr16:68229331-68229332:- [6]
Sequence GACTTTTTAAAAGACACAGGACCCTTAACTTTGCCCCAAAG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000251366.7; ENST00000473183.6; ENST00000565858.5
External Link RMBase: m6A_site_327150
mod ID: M6ASITE027900 Click to Show/Hide the Full List
mod site chr16:68229338-68229339:- [6]
Sequence CCAAATGGACTTTTTAAAAGACACAGGACCCTTAACTTTGC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565858.5; ENST00000251366.7; ENST00000473183.6
External Link RMBase: m6A_site_327151
mod ID: M6ASITE027901 Click to Show/Hide the Full List
mod site chr16:68229350-68229351:- [6]
Sequence AAAAGTTATTGACCAAATGGACTTTTTAAAAGACACAGGAC
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565858.5; ENST00000251366.7; ENST00000473183.6
External Link RMBase: m6A_site_327152
mod ID: M6ASITE027902 Click to Show/Hide the Full List
mod site chr16:68229394-68229395:- [6]
Sequence AGCCTCGGAAGCAATTTGGAACTCGATCTTCTCTTCCTTAA
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000251366.7; ENST00000565858.5; ENST00000473183.6
External Link RMBase: m6A_site_327153
mod ID: M6ASITE027903 Click to Show/Hide the Full List
mod site chr16:68229419-68229420:- [6]
Sequence CACGCATTAAATGGTACAGAACTGAAGCCTCGGAAGCAATT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000566774.1; ENST00000251366.7; ENST00000565858.5; ENST00000473183.6
External Link RMBase: m6A_site_327154
mod ID: M6ASITE027904 Click to Show/Hide the Full List
mod site chr16:68229459-68229460:- [6]
Sequence AGTTGCCCTGAACCCAGCAGACACCATGGAATGTCCTTTGC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000566774.1; ENST00000473183.6; ENST00000251366.7; ENST00000565858.5
External Link RMBase: m6A_site_327155
mod ID: M6ASITE027905 Click to Show/Hide the Full List
mod site chr16:68229468-68229469:- [6]
Sequence GGGAAAGCCAGTTGCCCTGAACCCAGCAGACACCATGGAAT
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000251366.7; ENST00000473183.6; ENST00000565858.5; ENST00000566774.1
External Link RMBase: m6A_site_327156
mod ID: M6ASITE027906 Click to Show/Hide the Full List
mod site chr16:68229517-68229518:- [6]
Sequence CTTGAATTTTAAAGGGGAGGACTTTCTGCCAACTTTTCTTG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000566774.1; ENST00000473183.6; ENST00000565858.5; ENST00000251366.7
External Link RMBase: m6A_site_327157
mod ID: M6ASITE027907 Click to Show/Hide the Full List
mod site chr16:68229546-68229547:- [6]
Sequence GCAGTAGGCCCCCACACAAAACCTTCAGGCTTGAATTTTAA
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000566774.1; ENST00000251366.7; ENST00000473183.6; ENST00000565858.5
External Link RMBase: m6A_site_327158
mod ID: M6ASITE027908 Click to Show/Hide the Full List
mod site chr16:68229576-68229577:- [5]
Sequence TGCTGCAGTATCACCAGAAGACATTAGGGGGCAGTAGGCCC
Motif Score 2.897386905
Cell/Tissue List HepG2; HEK293T; HeLa; hESC-HEK293T; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000566774.1; ENST00000565858.5; ENST00000473183.6; ENST00000251366.7
External Link RMBase: m6A_site_327159
mod ID: M6ASITE027909 Click to Show/Hide the Full List
mod site chr16:68229600-68229601:- [5]
Sequence ACCACAAACTATTTTGATGGACTGTGCTGCAGTATCACCAG
Motif Score 4.065041667
Cell/Tissue List HepG2; HEK293T; HeLa; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000566774.1; ENST00000473183.6; ENST00000565858.5; ENST00000251366.7
External Link RMBase: m6A_site_327160
mod ID: M6ASITE027910 Click to Show/Hide the Full List
mod site chr16:68229613-68229614:- [5]
Sequence AACAGATGGCAAAACCACAAACTATTTTGATGGACTGTGCT
Motif Score 2.627720238
Cell/Tissue List HepG2; HEK293T; HeLa; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000251366.7; ENST00000565858.5; ENST00000473183.6; ENST00000566774.1
External Link RMBase: m6A_site_327161
mod ID: M6ASITE027911 Click to Show/Hide the Full List
mod site chr16:68229620-68229621:- [6]
Sequence AAGGAGTAACAGATGGCAAAACCACAAACTATTTTGATGGA
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000473183.6; ENST00000251366.7; ENST00000565858.5; ENST00000566774.1
External Link RMBase: m6A_site_327162
mod ID: M6ASITE027912 Click to Show/Hide the Full List
mod site chr16:68229632-68229633:- [7]
Sequence CCAGGTGGGCATAAGGAGTAACAGATGGCAAAACCACAAAC
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000566774.1; ENST00000251366.7; ENST00000565858.5; ENST00000473183.6
External Link RMBase: m6A_site_327163
mod ID: M6ASITE027913 Click to Show/Hide the Full List
mod site chr16:68229699-68229700:- [6]
Sequence AGAGTATCTGGACCTCAGAGACCATGTTGTGCCAGGGGTGG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; H1B; hESCs; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565858.5; ENST00000566774.1; ENST00000473183.6; ENST00000251366.7
External Link RMBase: m6A_site_327164
mod ID: M6ASITE027914 Click to Show/Hide the Full List
mod site chr16:68229708-68229709:- [6]
Sequence CCTACCCTCAGAGTATCTGGACCTCAGAGACCATGTTGTGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; H1B; hESCs; Huh7; HEK293A-TOA; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000473183.6; ENST00000565858.5; ENST00000251366.7; ENST00000566774.1
External Link RMBase: m6A_site_327165
mod ID: M6ASITE027915 Click to Show/Hide the Full List
mod site chr16:68230031-68230032:- [4]
Sequence CCCCCAAAGACAATGGCTGGACCCTGCATGCAGGGCTGGGG
Motif Score 3.622404762
Cell/Tissue List HEK293T; HeLa; HepG2; H1A; H1B; hESCs; HEK293A-TOA; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000566774.1; ENST00000473183.6; ENST00000565858.5; ENST00000251366.7
External Link RMBase: m6A_site_327166
mod ID: M6ASITE027916 Click to Show/Hide the Full List
mod site chr16:68230042-68230043:- [4]
Sequence TCTGCCTGTTTCCCCCAAAGACAATGGCTGGACCCTGCATG
Motif Score 2.897386905
Cell/Tissue List HEK293T; HeLa; hESC-HEK293T; HepG2; H1A; H1B; hESCs; HEK293A-TOA; HEC-1-A
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000473183.6; ENST00000251366.7; ENST00000566774.1; ENST00000565858.5
External Link RMBase: m6A_site_327167
mod ID: M6ASITE027917 Click to Show/Hide the Full List
mod site chr16:68230861-68230862:- [8]
Sequence AGCCACTCAACTCTACCTGAACTACACAGCCTACTACCCAA
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000473183.6; ENST00000565858.5; ENST00000251366.7; ENST00000566774.1
External Link RMBase: m6A_site_327168
mod ID: M6ASITE027918 Click to Show/Hide the Full List
mod site chr16:68231554-68231555:- [5]
Sequence CTACACGGCCACCATTGAAGACATCCTGAGCTTTCTGGGGG
Motif Score 2.897386905
Cell/Tissue List HepG2; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000473183.6; ENST00000565858.5; ENST00000251366.7; ENST00000566774.1
External Link RMBase: m6A_site_327169
mod ID: M6ASITE027919 Click to Show/Hide the Full List
mod site chr16:68231599-68231600:- [5]
Sequence GGCACCTGGGACTGGGAGGGACTGTGTACGCCTCCGAGGCC
Motif Score 4.065041667
Cell/Tissue List HepG2; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000473183.6; ENST00000565858.5; ENST00000566774.1; ENST00000251366.7
External Link RMBase: m6A_site_327170
mod ID: M6ASITE027920 Click to Show/Hide the Full List
mod site chr16:68231609-68231610:- [5]
Sequence CCTTCCCACTGGCACCTGGGACTGGGAGGGACTGTGTACGC
Motif Score 4.065041667
Cell/Tissue List HepG2; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000473183.6; ENST00000566774.1; ENST00000251366.7; ENST00000565858.5
External Link RMBase: m6A_site_327171
mod ID: M6ASITE027921 Click to Show/Hide the Full List
mod site chr16:68231657-68231658:- [7]
Sequence CATCCGGCCCACTCCTTCCTACACTGACTGCCCCACTGCTG
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000473183.6; ENST00000251366.7; ENST00000566774.1; ENST00000565858.5
External Link RMBase: m6A_site_327172
mod ID: M6ASITE027922 Click to Show/Hide the Full List
mod site chr16:68231686-68231687:- [5]
Sequence CCTTCCTTACTAGGTCTTGAACCGCTATGCATCCGGCCCAC
Motif Score 2.930744048
Cell/Tissue List HepG2; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000473183.6; ENST00000565858.5; ENST00000566774.1; ENST00000251366.7
External Link RMBase: m6A_site_327173
mod ID: M6ASITE027923 Click to Show/Hide the Full List
mod site chr16:68231834-68231835:- [5]
Sequence CTGGGTAAGCGATACATTGAACTCTTCCGGAGCACTGCAGC
Motif Score 3.373380952
Cell/Tissue List HepG2; HeLa; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000566774.1; ENST00000565858.5; ENST00000251366.7; ENST00000473183.6
External Link RMBase: m6A_site_327174
mod ID: M6ASITE027924 Click to Show/Hide the Full List
mod site chr16:68231841-68231842:- [7]
Sequence GGGCATGCTGGGTAAGCGATACATTGAACTCTTCCGGAGCA
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000566774.1; ENST00000565858.5; ENST00000251366.7; ENST00000473183.6
External Link RMBase: m6A_site_327175
mod ID: M6ASITE027925 Click to Show/Hide the Full List
mod site chr16:68232038-68232039:- [5]
Sequence GTGATCCTGCGGCTGCGGGGACTGCCCTTCTCGGCTGGGCC
Motif Score 4.065041667
Cell/Tissue List HepG2; HeLa; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000565858.5; ENST00000566774.1; ENST00000473183.6; ENST00000565213.2; ENST00000251366.7
External Link RMBase: m6A_site_327176
mod ID: M6ASITE027926 Click to Show/Hide the Full List
mod site chr16:68232063-68232064:- [5]
Sequence TCGTTTCTTGTCACGGGAAGACCAAGTGATCCTGCGGCTGC
Motif Score 2.876744048
Cell/Tissue List HepG2; HeLa; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000565213.2; ENST00000566774.1; ENST00000473183.6; ENST00000565858.5; ENST00000251366.7
External Link RMBase: m6A_site_327177
mod ID: M6ASITE027927 Click to Show/Hide the Full List
mod site chr16:68232403-68232404:- [9]
Sequence CGGGACCTAGCGCTGCAGAGACACAAGCACCACATGGGCGT
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000473183.6; ENST00000251366.7; ENST00000566774.1; ENST00000565858.5; ENST00000565213.2
External Link RMBase: m6A_site_327178
mod ID: M6ASITE027928 Click to Show/Hide the Full List
mod site chr16:68232419-68232420:- [9]
Sequence TGTGGACAGCGAGCAGCGGGACCTAGCGCTGCAGAGACACA
Motif Score 3.622404762
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000565213.2; ENST00000251366.7; ENST00000565858.5; ENST00000566774.1; ENST00000473183.6
External Link RMBase: m6A_site_327179
mod ID: M6ASITE027929 Click to Show/Hide the Full List
mod site chr16:68232434-68232435:- [10]
Sequence GGCCCTCATCCGCTTTGTGGACAGCGAGCAGCGGGACCTAG
Motif Score 3.643047619
Cell/Tissue List HeLa; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000473183.6; ENST00000565213.2; ENST00000566774.1; ENST00000565858.5; ENST00000251366.7
External Link RMBase: m6A_site_327180
mod ID: M6ASITE027930 Click to Show/Hide the Full List
mod site chr16:68232543-68232544:- [9]
Sequence GGGTGGGTGGGCCCAATTGGACAGGCCTACCCAGGAGGCAC
Motif Score 3.643047619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000566774.1; ENST00000251366.7; ENST00000565858.5; ENST00000473183.6; ENST00000562738.5
External Link RMBase: m6A_site_327181
mod ID: M6ASITE027931 Click to Show/Hide the Full List
mod site chr16:68235649-68235650:- [6]
Sequence GGCGCGGGCAGAGCCGCTGGACAAGGTGCTGCAGCAGGTGA
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000565858.5; ENST00000562724.1; ENST00000473183.6; ENST00000564382.5; ENST00000564465.1; ENST00000569964.5; ENST00000251366.7
External Link RMBase: m6A_site_327182
mod ID: M6ASITE027932 Click to Show/Hide the Full List
mod site chr16:68235897-68235898:- [11]
Sequence GGGACCTGGGCTCGGACGAGACCGACTTAATCCTCCTAGTT
Motif Score 2.876744048
Cell/Tissue List HepG2; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000562724.1; ENST00000251366.7; ENST00000473183.6; ENST00000564382.5; ENST00000565858.5
External Link RMBase: m6A_site_327183
mod ID: M6ASITE027933 Click to Show/Hide the Full List
mod site chr16:68235914-68235915:- [11]
Sequence GGCGGGTGCGCTGGGACGGGACCTGGGCTCGGACGAGACCG
Motif Score 3.622404762
Cell/Tissue List HepG2; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000564382.5; ENST00000562724.1; ENST00000473183.6; ENST00000565858.5; ENST00000251366.7
External Link RMBase: m6A_site_327184
mod ID: M6ASITE027934 Click to Show/Hide the Full List
mod site chr16:68235980-68235981:- [11]
Sequence CGCGGCCGACCCCGCCGCGGACCCCTGCCCCTGGCCCGGAT
Motif Score 3.622404762
Cell/Tissue List HepG2; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000473183.6; ENST00000564382.5; ENST00000562724.1; ENST00000565858.5; ENST00000251366.7
External Link RMBase: m6A_site_327185
mod ID: M6ASITE027935 Click to Show/Hide the Full List
mod site chr16:68237534-68237535:- [12]
Sequence GTAAAGTGCTACTCGCTCGAACCCGCCGGGCGAAGGAAGCA
Motif Score 2.930744048
Cell/Tissue List H1A; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000564147.1; ENST00000562724.1; ENST00000564382.5
External Link RMBase: m6A_site_327186