m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00549)

Target Name	P2X purinoceptor 6 (P2RX6)
Synonyms	P2X6; ATP receptor; P2XM; Purinergic receptor; Purinergic receptor P2X-like 1 Click to Show/Hide
Gene Name	P2RX6
Chromosomal Location	22q11.21
Family	P2X receptor family
Function	Receptor for ATP that acts as a ligand-gated ion channel. Click to Show/Hide
Gene ID	9127
Uniprot ID	P2RX6_HUMAN
HGNC ID	HGNC:8538
KEGG ID	hsa:9127

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

P2RX6 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In RCC, METTL14 implicated m6A modification in RCC and down-regulated P2X purinoceptor 6 (P2RX6) protein translation.
Target Regulation	Down regulation
Responsed Disease	Renal cell carcinoma		ICD-11: 2C90	Disease Info
Cell Process	Cell invasion and metastasis
In-vitro Model	SW839	Clear cell renal cell carcinoma	Homo sapiens	CVCL_3604
	SN12C-PM6	Renal cell carcinoma	Homo sapiens	CVCL_9549
	OS-RC-2	Clear cell renal cell carcinoma	Homo sapiens	CVCL_1626
	HEK293	Normal	Homo sapiens	CVCL_0045
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
In-vivo Model	For the in vivo metastasis assays, luciferase labeled OS-RC-2 cells stably expressing OE-P2RX6 or pWPI-vector were injected into the tail vein of 5 weeks old BALB/c nude mice (Sipper-BK laboratory animal Company, Shanghai, China).

Renal cell carcinoma [ICD-11: 2C90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	In RCC, METTL14 implicated m6A modification in RCC and down-regulated P2X purinoceptor 6 (P2RX6) protein translation.
Responsed Disease	Renal cell carcinoma [ICD-11: 2C90]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cell invasion and metastasis
In-vitro Model	SW839	Clear cell renal cell carcinoma	Homo sapiens	CVCL_3604
	SN12C-PM6	Renal cell carcinoma	Homo sapiens	CVCL_9549
	OS-RC-2	Clear cell renal cell carcinoma	Homo sapiens	CVCL_1626
	HEK293	Normal	Homo sapiens	CVCL_0045
	786-O	Renal cell carcinoma	Homo sapiens	CVCL_1051
In-vivo Model	For the in vivo metastasis assays, luciferase labeled OS-RC-2 cells stably expressing OE-P2RX6 or pWPI-vector were injected into the tail vein of 5 weeks old BALB/c nude mice (Sipper-BK laboratory animal Company, Shanghai, China).

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00549)

P2X purinoceptor 6 (P2RX6)

N6-methyladenosine (m6A)

In total 13 m6A sequence/site(s) in this target gene
mod ID: M6ASITE056637		Click to Show/Hide the Full List
mod site	chr22:21026548-21026549:+		[2]
Sequence	CCACTGCTGCTGGGAGTCAGACACAGACACCAGGATGGCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000401443.5; ENST00000432930.5; ENST00000422210.5; ENST00000487342.1; ENST00000413302.6; ENST00000442475.5
External Link	RMBase: m6A_site_556423
mod ID: M6ASITE056638		Click to Show/Hide the Full List
mod site	chr22:21026554-21026555:+		[2]
Sequence	CTGCTGGGAGTCAGACACAGACACCAGGATGGCCCTGTCCA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000422210.5; ENST00000487342.1; ENST00000442475.5; ENST00000413302.6; ENST00000401443.5; ENST00000432930.5
External Link	RMBase: m6A_site_556424
mod ID: M6ASITE056639		Click to Show/Hide the Full List
mod site	chr22:21027764-21027765:+		[2]
Sequence	GGGCCAGGGGTGGGGCTGAGACTGGGCTGACATCTAGAATC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000432930.5; ENST00000413302.6; ENST00000442475.5; ENST00000422210.5
External Link	RMBase: m6A_site_556425
mod ID: M6ASITE056640		Click to Show/Hide the Full List
mod site	chr22:21027977-21027978:+		[2]
Sequence	GAAGCTGATGTCATGGCTGGACAAAGTCACGGAGTAAAGCC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000422210.5; ENST00000432930.5; ENST00000442475.5; ENST00000413302.6
External Link	RMBase: m6A_site_556426
mod ID: M6ASITE056641		Click to Show/Hide the Full List
mod site	chr22:21028067-21028068:+		[2]
Sequence	TTGGGGGGCATCTATGGTAGACATGGCACAGCCATGAAGAG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556427
mod ID: M6ASITE056642		Click to Show/Hide the Full List
mod site	chr22:21028088-21028089:+		[2]
Sequence	CATGGCACAGCCATGAAGAGACCAGTGGGGTGGTGCAGGGT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556428
mod ID: M6ASITE056643		Click to Show/Hide the Full List
mod site	chr22:21028111-21028112:+		[2]
Sequence	AGTGGGGTGGTGCAGGGTGGACTTGGGGACCCTACCCCTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556429
mod ID: M6ASITE056644		Click to Show/Hide the Full List
mod site	chr22:21028119-21028120:+		[2]
Sequence	GGTGCAGGGTGGACTTGGGGACCCTACCCCTGAAGACTGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556430
mod ID: M6ASITE056645		Click to Show/Hide the Full List
mod site	chr22:21028134-21028135:+		[2]
Sequence	TGGGGACCCTACCCCTGAAGACTGAGGCCCTGCAGCTACCA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556431
mod ID: M6ASITE056646		Click to Show/Hide the Full List
mod site	chr22:21028177-21028178:+		[2]
Sequence	TGGGCTAGAAGGTAACTGGAACAGGCCTGGGCACTTGTGCA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556432
mod ID: M6ASITE056647		Click to Show/Hide the Full List
mod site	chr22:21028260-21028261:+		[2]
Sequence	CCCTTGAAGAGTGGGCAAAGACAGCAAGAGAGCTGCAGCCT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556433
mod ID: M6ASITE056648		Click to Show/Hide the Full List
mod site	chr22:21028517-21028518:+		[2]
Sequence	GACCCCATGCCTGTCATGGAACCCTCCTTGCCTGGTGTGTG
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556434
mod ID: M6ASITE056649		Click to Show/Hide the Full List
mod site	chr22:21028606-21028607:+		[2]
Sequence	TGACTCAGGGTGGTCCCAGGACTGGCACCTACTCTTTAGAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000413302.6
External Link	RMBase: m6A_site_556435

Ref 1	The m(6)A-suppressed P2RX6 activation promotes renal cancer cells migration and invasion through ATP-induced Ca(2+) influx modulating ERK1/2 phosphorylation and MMP9 signaling pathway. J Exp Clin Cancer Res. 2019 Jun 3;38(1):233. doi: 10.1186/s13046-019-1223-y.
Ref 2	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map