m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00514)
Target Name TNF alpha-induced protein 3 (TNFAIP3)
Synonyms
TNF alpha-induced protein 3; OTU domain-containing protein 7C; Putative DNA-binding protein A20; Zinc finger protein A20
    Click to Show/Hide
Gene Name TNFAIP3
Chromosomal Location 6q23.3
Family Peptidase C64 family
Function
Ubiquitin-editing enzyme that contains both ubiquitin ligase and deubiquitinase activities. Involved in immune and inflammatory responses signaled by cytokines, such as TNF-alpha and IL-1 beta, or pathogens via Toll-like receptors (TLRs) through terminating NF-kappa-B activity. Essential component of a ubiquitin-editing protein complex, comprising also RNF11, ITCH and TAX1BP1, that ensures the transient nature of inflammatory signaling pathways. In cooperation with TAX1BP1 promotes disassembly of E2-E3 ubiquitin protein ligase complexes in IL-1R and TNFR-1 pathways; affected are at least E3 ligases TRAF6, TRAF2 and BIRC2, and E2 ubiquitin-conjugating enzymes UBE2N and UBE2D3. In cooperation with TAX1BP1 promotes ubiquitination of UBE2N and proteasomal degradation of UBE2N and UBE2D3. Upon TNF stimulation, deubiquitinates 'Lys-63'-polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteasomal degradation and consequently termination of the TNF- or LPS-mediated activation of NF-kappa-B. Deubiquitinates TRAF6 probably acting on 'Lys-63'-linked polyubiquitin. Upon T-cell receptor (TCR)-mediated T-cell activation, deubiquitinates 'Lys-63'-polyubiquitin chains on MALT1 thereby mediating disassociation of the CBM (CARD11:BCL10:MALT1) and IKK complexes and preventing sustained IKK activation. Deubiquitinates NEMO/IKBKG; the function is facilitated by TNIP1 and leads to inhibition of NF-kappa-B activation. Upon stimulation by bacterial peptidoglycans, probably deubiquitinates RIPK2. Can also inhibit I-kappa-B-kinase (IKK) through a non-catalytic mechanism which involves polyubiquitin; polyubiquitin promotes association with IKBKG and prevents IKK MAP3K7-mediated phosphorylation. Targets TRAF2 for lysosomal degradation. In vitro able to deubiquitinate 'Lys-11'-, 'Lys-48'- and 'Lys-63' polyubiquitin chains. Inhibitor of programmed cell death. Has a role in the function of the lymphoid system. Required for LPS-induced production of pro-inflammatory cytokines and IFN beta in LPS-tolerized macrophages.
    Click to Show/Hide
Gene ID 7128
Uniprot ID
TNAP3_HUMAN
HGNC ID
HGNC:11896
KEGG ID
hsa:7128
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TNFAIP3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line 143B cell line Homo sapiens
Treatment: siALKBH5 transfected 143B cells
Control: siControl 143B cells
 GSE154528
Regulation
logFC: 1.17E+00
p-value: 2.43E-06
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Lower expression TNF alpha-induced protein 3 (TNFAIP3) resulted in the enhanced M1 polarization of retinal microglia in diabetic retinopathy, which was caused by ALKBH5 mediated m6A modification.
Target Regulation Down regulation
Responsed Disease Diabetic retinopathy ICD-11: 9B71.0
 Disease Info 
In-vitro Model BV-2 Normal Mus musculus CVCL_0182
In-vivo Model The male Sprague-Dawley rats (8 weeks old, 200-220 g) were purchased from the Laboratory Animal Center of Sun Yat-sen University. Streptozotocin (Sigma, USA) was given by intraperitoneal injection at a dose of 60 mg/Kg to induce diabetics rats, while the control rats were given by empty citrate buffer. One week after induction, those rats with blood glucose levels > 16.7 mmol/L for three times were considered as successful inducted diabetes. All the rats did not receive insulin during the experiments.In the intraocular injection experiments, rats confirmed as the DM model (blood glucose levels > 16.7 mmol/L for three times) were anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/Kg). A total of 10 ul DMEM with 1*109 TU lentiviruses (A20-overexpression, OE-A20 group) or the same volume of DMEM with control lentiviruses (OE-NC group) was injected into the vitreous cavity using a 33-gauge needle. This treatment was performed one time per month, and the rats were sacrificed for further experiments at the 3 months.
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between TNFAIP3 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.94E+00 GSE49339
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary YTHDF2 enhanced TMZ resistance in GBM by activation of the PI3K/Akt and NF-Kappa-B signalling pathways via inhibition of EPHB3 and TNF alpha-induced protein 3 (TNFAIP3).
Target Regulation Down regulation
Responsed Disease Glioblastoma ICD-11: 2A00.00
 Disease Info 
Responsed Drug Temozolomide Approved
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Cell Process RNA stability
In-vitro Model T98G Glioblastoma Homo sapiens CVCL_0556
LN-229 Glioblastoma Homo sapiens CVCL_0393
In-vivo Model 5 × 106 infected T98G cells (LV-NC or LV-YTHDF2) were injected into the flanks of mice through subcutaneous.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary MiR-19a regulated TNF alpha-induced protein 3 (TNFAIP3) degradation by downregulating the expression of YTH N6-methyladenosine RNA-binding protein 2 (YTHDF2). The circGARS sponges miR-19a to regulate YTHDF2 expression to promote SLE progression through the A20/NF-Kappa-B axis and acts as an independent biomarker to help the treatment of SLE patients.
Target Regulation Up regulation
Responsed Disease Lupus erythematosus ICD-11: 4A40
 Disease Info 
Cell Process Immunity
In-vitro Model PBMCs (Human peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood and identified as any blood cell with a round nucleus)
Brain cancer [ICD-11: 2A00]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary YTHDF2 enhanced TMZ resistance in GBM by activation of the PI3K/Akt and NF-Kappa-B signalling pathways via inhibition of EPHB3 and TNF alpha-induced protein 3 (TNFAIP3).
Responsed Disease Glioblastoma [ICD-11: 2A00.00]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Temozolomide Approved
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Cell Process RNA stability
In-vitro Model T98G Glioblastoma Homo sapiens CVCL_0556
LN-229 Glioblastoma Homo sapiens CVCL_0393
In-vivo Model 5 × 106 infected T98G cells (LV-NC or LV-YTHDF2) were injected into the flanks of mice through subcutaneous.
Lupus erythematosus [ICD-11: 4A40]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary MiR-19a regulated TNF alpha-induced protein 3 (TNFAIP3) degradation by downregulating the expression of YTH N6-methyladenosine RNA-binding protein 2 (YTHDF2). The circGARS sponges miR-19a to regulate YTHDF2 expression to promote SLE progression through the A20/NF-Kappa-B axis and acts as an independent biomarker to help the treatment of SLE patients.
Responsed Disease Lupus erythematosus [ICD-11: 4A40]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Up regulation
Cell Process Immunity
In-vitro Model PBMCs (Human peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood and identified as any blood cell with a round nucleus)
Retinopathy [ICD-11: 9B71]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Lower expression TNF alpha-induced protein 3 (TNFAIP3) resulted in the enhanced M1 polarization of retinal microglia in diabetic retinopathy, which was caused by ALKBH5 mediated m6A modification.
Responsed Disease Diabetic retinopathy [ICD-11: 9B71.0]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Down regulation
In-vitro Model BV-2 Normal Mus musculus CVCL_0182
In-vivo Model The male Sprague-Dawley rats (8 weeks old, 200-220 g) were purchased from the Laboratory Animal Center of Sun Yat-sen University. Streptozotocin (Sigma, USA) was given by intraperitoneal injection at a dose of 60 mg/Kg to induce diabetics rats, while the control rats were given by empty citrate buffer. One week after induction, those rats with blood glucose levels > 16.7 mmol/L for three times were considered as successful inducted diabetes. All the rats did not receive insulin during the experiments.In the intraocular injection experiments, rats confirmed as the DM model (blood glucose levels > 16.7 mmol/L for three times) were anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/Kg). A total of 10 ul DMEM with 1*109 TU lentiviruses (A20-overexpression, OE-A20 group) or the same volume of DMEM with control lentiviruses (OE-NC group) was injected into the vitreous cavity using a 33-gauge needle. This treatment was performed one time per month, and the rats were sacrificed for further experiments at the 3 months.
Temozolomide [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary YTHDF2 enhanced TMZ resistance in GBM by activation of the PI3K/Akt and NF-Kappa-B signalling pathways via inhibition of EPHB3 and TNF alpha-induced protein 3 (TNFAIP3).
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Glioblastoma ICD-11: 2A00.00
 Disease Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Cell Process RNA stability
In-vitro Model T98G Glioblastoma Homo sapiens CVCL_0556
LN-229 Glioblastoma Homo sapiens CVCL_0393
In-vivo Model 5 × 106 infected T98G cells (LV-NC or LV-YTHDF2) were injected into the flanks of mice through subcutaneous.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00514)
TNF alpha-induced protein 3 (TNFAIP3)
N6-methyladenosine (m6A)
In total 68 m6A sequence/site(s) in this target gene
mod ID: M6ASITE077402 Click to Show/Hide the Full List
mod site chr6:137867253-137867254:+ [5]
Sequence ACTGAAACGGGGCAAAGCAGACTGCGCAGTCTGCAGTCTTC
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HepG2; A549; MT4; Jurkat; CD4T; GSC-11
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000421450.1
External Link RMBase: m6A_site_735358
mod ID: M6ASITE077403 Click to Show/Hide the Full List
mod site chr6:137867456-137867457:+ [5]
Sequence GCGCTCCTGCCTTGACCAGGACTTGGGACTTTGCGAAAGGA
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; A549; LCLs; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000421450.1; ENST00000237289.8; ENST00000420009.5
External Link RMBase: m6A_site_735359
mod ID: M6ASITE077404 Click to Show/Hide the Full List
mod site chr6:137867463-137867464:+ [5]
Sequence TGCCTTGACCAGGACTTGGGACTTTGCGAAAGGATCGCGGG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; A549; LCLs; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000237289.8; ENST00000421450.1; ENST00000612899.5; ENST00000420009.5
External Link RMBase: m6A_site_735360
mod ID: M6ASITE077405 Click to Show/Hide the Full List
mod site chr6:137867668-137867669:+ [6]
Sequence TGGTTTTGCAGCGCTCCTGGACTGGGAGTTTGTTGGACGTT
Motif Score 4.065041667
Cell/Tissue List CD34; HeLa; A549; MM6; Jurkat; CD4T; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000237289.8; ENST00000420009.5; ENST00000433680.1; ENST00000421450.1
External Link RMBase: m6A_site_735362
mod ID: M6ASITE077406 Click to Show/Hide the Full List
mod site chr6:137871235-137871236:+ [5]
Sequence TTGGAGAGCACAATGGCTGAACAAGTCCTTCCTCAGGCTTT
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000621150.3; ENST00000620204.3; ENST00000237289.8; ENST00000619035.4; ENST00000615468.4; ENST00000421450.1; ENST00000433680.1; ENST00000612899.5; ENST00000614035.4; ENST00000420009.5
External Link RMBase: m6A_site_735373
mod ID: M6ASITE077407 Click to Show/Hide the Full List
mod site chr6:137871299-137871300:+ [5]
Sequence CTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAA
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; MT4; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615468.4; ENST00000614035.4; ENST00000420009.5; ENST00000433680.1; ENST00000621150.3; ENST00000421450.1; ENST00000619035.4; ENST00000612899.5; ENST00000620204.3; ENST00000237289.8
External Link RMBase: m6A_site_735374
mod ID: M6ASITE077408 Click to Show/Hide the Full List
mod site chr6:137871309-137871310:+ [5]
Sequence ACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; MT4; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000237289.8; ENST00000614035.4; ENST00000619035.4; ENST00000612899.5; ENST00000621150.3; ENST00000433680.1; ENST00000420009.5; ENST00000620204.3; ENST00000615468.4
External Link RMBase: m6A_site_735375
mod ID: M6ASITE077409 Click to Show/Hide the Full List
mod site chr6:137871319-137871320:+ [5]
Sequence ACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCA
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34; MT4; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000420009.5; ENST00000621150.3; ENST00000433680.1; ENST00000237289.8; ENST00000612899.5; ENST00000614035.4; ENST00000615468.4; ENST00000619035.4; ENST00000620204.3
External Link RMBase: m6A_site_735376
mod ID: M6ASITE077410 Click to Show/Hide the Full List
mod site chr6:137871350-137871351:+ [5]
Sequence GGATCATTCATCATTTTAAAACCATGCACCGATACACACTG
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34; MT4; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000420009.5; ENST00000614035.4; ENST00000619035.4; ENST00000615468.4; ENST00000621150.3; ENST00000620204.3; ENST00000237289.8; ENST00000433680.1
External Link RMBase: m6A_site_735377
mod ID: M6ASITE077411 Click to Show/Hide the Full List
mod site chr6:137871383-137871384:+ [5]
Sequence ACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAG
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; MT4; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615468.4; ENST00000433680.1; ENST00000612899.5; ENST00000237289.8; ENST00000614035.4; ENST00000620204.3; ENST00000420009.5; ENST00000621150.3; ENST00000619035.4
External Link RMBase: m6A_site_735378
mod ID: M6ASITE077412 Click to Show/Hide the Full List
mod site chr6:137871441-137871442:+ [5]
Sequence CAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; MT4; Huh7; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000621150.3; ENST00000433680.1; ENST00000620204.3; ENST00000237289.8; ENST00000615468.4; ENST00000619035.4; ENST00000420009.5; ENST00000614035.4; ENST00000612899.5
External Link RMBase: m6A_site_735379
mod ID: M6ASITE077413 Click to Show/Hide the Full List
mod site chr6:137871472-137871473:+ [5]
Sequence ACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGT
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; MT4; Huh7; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615468.4; ENST00000614035.4; ENST00000621150.3; ENST00000433680.1; ENST00000237289.8; ENST00000420009.5; ENST00000619035.4; ENST00000612899.5; ENST00000620204.3
External Link RMBase: m6A_site_735380
mod ID: M6ASITE077414 Click to Show/Hide the Full List
mod site chr6:137874898-137874899:+ [5]
Sequence GTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGA
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; MT4; Huh7; Jurkat; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000237289.8; ENST00000420009.5; ENST00000614035.4; ENST00000621150.3; ENST00000612899.5; ENST00000615468.4; ENST00000619035.4
External Link RMBase: m6A_site_735381
mod ID: M6ASITE077415 Click to Show/Hide the Full List
mod site chr6:137874904-137874905:+ [5]
Sequence GTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGC
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; MT4; Huh7; Jurkat; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000615468.4; ENST00000614035.4; ENST00000621150.3; ENST00000420009.5; ENST00000619035.4; ENST00000612899.5; ENST00000237289.8
External Link RMBase: m6A_site_735382
mod ID: M6ASITE077416 Click to Show/Hide the Full List
mod site chr6:137874945-137874946:+ [5]
Sequence TGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; MT4; Huh7; peripheral-blood; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000614035.4; ENST00000615468.4; ENST00000621150.3; ENST00000612899.5; ENST00000420009.5; ENST00000619035.4; ENST00000237289.8
External Link RMBase: m6A_site_735383
mod ID: M6ASITE077417 Click to Show/Hide the Full List
mod site chr6:137875706-137875707:+ [5]
Sequence GAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTT
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; MT4; Huh7; peripheral-blood
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000237289.8; ENST00000620204.3; ENST00000621150.3; ENST00000615468.4; ENST00000612899.5; ENST00000619035.4; ENST00000614035.4
External Link RMBase: m6A_site_735384
mod ID: M6ASITE077418 Click to Show/Hide the Full List
mod site chr6:137875733-137875734:+ [5]
Sequence TATCAAAATGGCTTCCACAGACACACCCATGGCCCGAAGTG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000621150.3; ENST00000615468.4; ENST00000237289.8; ENST00000619035.4; ENST00000614035.4; ENST00000612899.5
External Link RMBase: m6A_site_735385
mod ID: M6ASITE077419 Click to Show/Hide the Full List
mod site chr6:137875755-137875756:+ [5]
Sequence ACACCCATGGCCCGAAGTGGACTTCAGTACAACTCACTGGA
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000621150.3; ENST00000614035.4; ENST00000619035.4; ENST00000615468.4; ENST00000237289.8; ENST00000620204.3; ENST00000612899.5
External Link RMBase: m6A_site_735386
mod ID: M6ASITE077420 Click to Show/Hide the Full List
mod site chr6:137876154-137876155:+ [6]
Sequence ACCCTTGGTGACCCTGAAGGACAGTGGGCCTGGTGAGAAAA
Motif Score 3.643047619
Cell/Tissue List CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615468.4; ENST00000614035.4; ENST00000620204.3; ENST00000485192.1; ENST00000237289.8; ENST00000621150.3; ENST00000619035.4; ENST00000612899.5
External Link RMBase: m6A_site_735387
mod ID: M6ASITE077421 Click to Show/Hide the Full List
mod site chr6:137877105-137877106:+ [6]
Sequence TGTTCCACTTGTTAACAGAGACCGGGGAAGATTTGAAGACT
Motif Score 2.876744048
Cell/Tissue List CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000621150.3; ENST00000614035.4; ENST00000615468.4; ENST00000237289.8; ENST00000619035.4; ENST00000620204.3; ENST00000485192.1; ENST00000612899.5
External Link RMBase: m6A_site_735388
mod ID: M6ASITE077422 Click to Show/Hide the Full List
mod site chr6:137877123-137877124:+ [6]
Sequence AGACCGGGGAAGATTTGAAGACTTAAAAGTTCACTTTTTGA
Motif Score 3.319380952
Cell/Tissue List CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000612899.5; ENST00000237289.8; ENST00000621150.3; ENST00000615468.4; ENST00000619035.4; ENST00000614035.4; ENST00000485192.1
External Link RMBase: m6A_site_735389
mod ID: M6ASITE077423 Click to Show/Hide the Full List
mod site chr6:137877222-137877223:+ [6]
Sequence AATCCCCGTCCAAGGCTGGGACCATGGCACAACTCATCTCA
Motif Score 3.622404762
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000612899.5; ENST00000485192.1; ENST00000621150.3; ENST00000619035.4; ENST00000615468.4; ENST00000237289.8; ENST00000614035.4; ENST00000620204.3
External Link RMBase: m6A_site_735390
mod ID: M6ASITE077424 Click to Show/Hide the Full List
mod site chr6:137878485-137878486:+ [5]
Sequence CTGGTAGATGATTACTTTGAACTTGTTCAGCATGAGTACAA
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; Jurkat; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000237289.8; ENST00000620204.3; ENST00000619035.4; ENST00000614035.4; ENST00000612899.5; ENST00000615468.4; ENST00000485192.1; ENST00000621150.3
External Link RMBase: m6A_site_735391
mod ID: M6ASITE077425 Click to Show/Hide the Full List
mod site chr6:137878520-137878521:+ [5]
Sequence GTACAAGAAATGGCAGGAAAACAGCGAGCAGGGGAGGAGAG
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; Jurkat; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000621150.3; ENST00000485192.1; ENST00000614035.4; ENST00000620204.3; ENST00000619035.4; ENST00000237289.8; ENST00000615468.4; ENST00000612899.5
External Link RMBase: m6A_site_735392
mod ID: M6ASITE077426 Click to Show/Hide the Full List
mod site chr6:137878566-137878567:+ [5]
Sequence CACGCCCAGAATCCCATGGAACCTTCCGTGCCCCAGCTTTC
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HEK293T; fibroblasts; MM6; Jurkat; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000615468.4; ENST00000621150.3; ENST00000237289.8; ENST00000614035.4; ENST00000619035.4; ENST00000620204.3
External Link RMBase: m6A_site_735393
mod ID: M6ASITE077427 Click to Show/Hide the Full List
mod site chr6:137878640-137878641:+ [5]
Sequence CCCCTTCTTCATGTCTGTGAACACCCAGCCTTTATGCCATG
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000619035.4; ENST00000615468.4; ENST00000614035.4; ENST00000237289.8; ENST00000621150.3; ENST00000620204.3
External Link RMBase: m6A_site_735394
mod ID: M6ASITE077428 Click to Show/Hide the Full List
mod site chr6:137878691-137878692:+ [5]
Sequence GAGGCGGCAAAAGAATCAAAACAAACTCCCAAAGCTGAACT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615468.4; ENST00000619035.4; ENST00000621150.3; ENST00000612899.5; ENST00000237289.8; ENST00000620204.3; ENST00000614035.4
External Link RMBase: m6A_site_735395
mod ID: M6ASITE077429 Click to Show/Hide the Full List
mod site chr6:137878709-137878710:+ [5]
Sequence AAACAAACTCCCAAAGCTGAACTCCAAGCCGGGCCCTGAGG
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000612899.5; ENST00000621150.3; ENST00000620204.3; ENST00000614035.4; ENST00000615468.4; ENST00000237289.8; ENST00000619035.4
External Link RMBase: m6A_site_735396
mod ID: M6ASITE077430 Click to Show/Hide the Full List
mod site chr6:137878790-137878791:+ [5]
Sequence CTATGAGCCCTTGGCGTGGAACCCTGAGGAGTCCACTGGGG
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1A; fibroblasts; GM12878; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000614035.4; ENST00000621150.3; ENST00000619035.4; ENST00000620204.3; ENST00000615468.4; ENST00000612899.5; ENST00000237289.8
External Link RMBase: m6A_site_735397
mod ID: M6ASITE077431 Click to Show/Hide the Full List
mod site chr6:137878861-137878862:+ [5]
Sequence GCCCTTTTCTGTTCAGTGAGACCACTGCCATGAAGTGCAGG
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; GM12878; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000619035.4; ENST00000615468.4; ENST00000621150.3; ENST00000612899.5; ENST00000237289.8
External Link RMBase: m6A_site_735398
mod ID: M6ASITE077432 Click to Show/Hide the Full List
mod site chr6:137878932-137878933:+ [7]
Sequence CAGCACAACGGATTTTGTGAACGTTGCCACAACGCCCGGCA
Motif Score 2.925321429
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000237289.8; ENST00000619035.4; ENST00000615468.4; ENST00000612899.5; ENST00000620204.3; ENST00000621150.3
External Link RMBase: m6A_site_735399
mod ID: M6ASITE077433 Click to Show/Hide the Full List
mod site chr6:137878976-137878977:+ [5]
Sequence TCACGCCAGCCACGCCCCAGACCACACAAGGCACTTGGATC
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; fibroblasts; GM12878; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000620204.3; ENST00000237289.8; ENST00000615468.4; ENST00000621150.3; ENST00000619035.4
External Link RMBase: m6A_site_735400
mod ID: M6ASITE077434 Click to Show/Hide the Full List
mod site chr6:137879035-137879036:+ [5]
Sequence GCCTCCAGGATGTTACCAGGACATTTAATGGGATCTGCAGT
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000621150.3; ENST00000237289.8; ENST00000612899.5; ENST00000620204.3; ENST00000615468.4; ENST00000619035.4
External Link RMBase: m6A_site_735401
mod ID: M6ASITE077435 Click to Show/Hide the Full List
mod site chr6:137879071-137879072:+ [5]
Sequence GCAGTACTTGCTTCAAAAGGACTACAGCAGAGGCCTCCTCC
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; CD8T; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000612899.5; ENST00000237289.8; ENST00000620204.3; ENST00000615468.4; ENST00000619035.4
External Link RMBase: m6A_site_735402
mod ID: M6ASITE077436 Click to Show/Hide the Full List
mod site chr6:137879195-137879196:+ [7]
Sequence TTCTTGCCACAGAGCTGGAAACGACGCCCCTGCTGGCTGCC
Motif Score 2.179660714
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000237289.8; ENST00000612899.5; ENST00000619035.4; ENST00000615468.4; ENST00000620204.3
External Link RMBase: m6A_site_735403
mod ID: M6ASITE077437 Click to Show/Hide the Full List
mod site chr6:137879233-137879234:+ [5]
Sequence GCCTGTCTCAAGCTGCACGGACTCCTGGGGACAGGACGGGG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000620204.3; ENST00000615468.4; ENST00000619035.4; ENST00000237289.8
External Link RMBase: m6A_site_735404
mod ID: M6ASITE077438 Click to Show/Hide the Full List
mod site chr6:137879243-137879244:+ [5]
Sequence AGCTGCACGGACTCCTGGGGACAGGACGGGGACGAGCAAGT
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000612899.5; ENST00000619035.4; ENST00000237289.8; ENST00000615468.4
External Link RMBase: m6A_site_735405
mod ID: M6ASITE077439 Click to Show/Hide the Full List
mod site chr6:137879248-137879249:+ [7]
Sequence CACGGACTCCTGGGGACAGGACGGGGACGAGCAAGTGCAGA
Motif Score 3.616982143
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000615468.4; ENST00000620204.3; ENST00000237289.8; ENST00000612899.5; ENST00000619035.4
External Link RMBase: m6A_site_735406
mod ID: M6ASITE077440 Click to Show/Hide the Full List
mod site chr6:137879254-137879255:+ [7]
Sequence CTCCTGGGGACAGGACGGGGACGAGCAAGTGCAGAAAAGCC
Motif Score 3.616982143
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000620204.3; ENST00000615468.4; ENST00000619035.4; ENST00000237289.8; ENST00000612899.5
External Link RMBase: m6A_site_735407
mod ID: M6ASITE077441 Click to Show/Hide the Full List
mod site chr6:137879293-137879294:+ [5]
Sequence CCGGCTGCGTGTATTTTGGGACTCCAGAAAACAAGGGCTTT
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000615468.4; ENST00000237289.8; ENST00000612899.5; ENST00000619035.4
External Link RMBase: m6A_site_735408
mod ID: M6ASITE077442 Click to Show/Hide the Full List
mod site chr6:137879303-137879304:+ [5]
Sequence GTATTTTGGGACTCCAGAAAACAAGGGCTTTTGCACACTGT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000619035.4; ENST00000615468.4; ENST00000620204.3; ENST00000612899.5; ENST00000237289.8
External Link RMBase: m6A_site_735409
mod ID: M6ASITE077443 Click to Show/Hide the Full List
mod site chr6:137879345-137879346:+ [5]
Sequence TTTCATCGAGTACAGAGAAAACAAACGTGAGTGAAGTGGTT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000619035.4; ENST00000620204.3; ENST00000237289.8; ENST00000615468.4
External Link RMBase: m6A_site_735410
mod ID: M6ASITE077444 Click to Show/Hide the Full List
mod site chr6:137880121-137880122:+ [5]
Sequence CACAGCGTCCAGGTTCCAGAACACCATTCCGTGCCTGGGGA
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; A549; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TREX; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000619035.4; ENST00000620204.3; ENST00000237289.8; ENST00000615468.4; ENST00000612899.5
External Link RMBase: m6A_site_735411
mod ID: M6ASITE077445 Click to Show/Hide the Full List
mod site chr6:137880237-137880238:+ [5]
Sequence GATTTCATGAGGCCAAAAGGACAGAAGAGCAACTGGTGAGA
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; Jurkat; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000619035.4; ENST00000237289.8; ENST00000612899.5; ENST00000620204.3; ENST00000615468.4
External Link RMBase: m6A_site_735412
mod ID: M6ASITE077446 Click to Show/Hide the Full List
mod site chr6:137881064-137881065:+ [5]
Sequence AGCGCAGAGATGTGCCTCGAACCACACAAAGCACCTCAAGG
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; Jurkat; CD4T; peripheral-blood; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615468.4; ENST00000612899.5; ENST00000620204.3; ENST00000619035.4; ENST00000237289.8
External Link RMBase: m6A_site_735413
mod ID: M6ASITE077447 Click to Show/Hide the Full List
mod site chr6:137881113-137881114:+ [5]
Sequence CGCCCGGGCCTCCTGCAAGAACATCCTGGCCTGCCGCAGCG
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000619035.4; ENST00000620204.3; ENST00000612899.5; ENST00000237289.8; ENST00000615468.4
External Link RMBase: m6A_site_735414
mod ID: M6ASITE077448 Click to Show/Hide the Full List
mod site chr6:137881212-137881213:+ [5]
Sequence GGGTGAGCCTGCCCCCGAAGACCCCCCCAAGCAGCGTTGCC
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000237289.8; ENST00000615468.4; ENST00000620204.3; ENST00000612899.5
External Link RMBase: m6A_site_735415
mod ID: M6ASITE077449 Click to Show/Hide the Full List
mod site chr6:137881325-137881326:+ [5]
Sequence AGATGTATGGCTAACCGGAAACAGGTGGGTCACCTCCTGCA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000237289.8; ENST00000620204.3; ENST00000612899.5; ENST00000615468.4
External Link RMBase: m6A_site_735416
mod ID: M6ASITE077450 Click to Show/Hide the Full List
mod site chr6:137881392-137881393:+ [5]
Sequence ATCATGGTGCTATCCTCTGAACCCCTCAGCTGCCACTGCAA
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; MM6; CD4T; peripheral-blood; GSC-11; iSLK; MSC; endometrial; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000612899.5; ENST00000237289.8; ENST00000620204.3; rmsk_2085942; ENST00000615468.4
External Link RMBase: m6A_site_735417
mod ID: M6ASITE077451 Click to Show/Hide the Full List
mod site chr6:137881597-137881598:+ [5]
Sequence TACCAAGCAGGAGGCCAGGAACTTCTTTGGACTTGGAAGGT
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000612899.5; ENST00000237289.8; ENST00000615468.4; ENST00000620204.3
External Link RMBase: m6A_site_735418
mod ID: M6ASITE077452 Click to Show/Hide the Full List
mod site chr6:137881607-137881608:+ [5]
Sequence GAGGCCAGGAACTTCTTTGGACTTGGAAGGTGTGCGGGGAC
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000615468.4; ENST00000612899.5; ENST00000237289.8
External Link RMBase: m6A_site_735419
mod ID: M6ASITE077453 Click to Show/Hide the Full List
mod site chr6:137881626-137881627:+ [5]
Sequence GACTTGGAAGGTGTGCGGGGACTGGCCGAGGCCCCTGCACC
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000612899.5; ENST00000237289.8; ENST00000615468.4; ENST00000620204.3
External Link RMBase: m6A_site_735420
mod ID: M6ASITE077454 Click to Show/Hide the Full List
mod site chr6:137881659-137881660:+ [5]
Sequence CCTGCACCCTGCGCATCAGGACTGCTTCATCGTCTTGGCTG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000237289.8; ENST00000612899.5; ENST00000615468.4; ENST00000620204.3
External Link RMBase: m6A_site_735421
mod ID: M6ASITE077455 Click to Show/Hide the Full List
mod site chr6:137881693-137881694:+ [5]
Sequence TTGGCTGAGAAAGGGAAAAGACACACAAGTCGCGTGGGTTG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000620204.3; ENST00000612899.5; ENST00000237289.8; ENST00000615468.4
External Link RMBase: m6A_site_735422
mod ID: M6ASITE077456 Click to Show/Hide the Full List
mod site chr6:137881829-137881830:+ [7]
Sequence AGGAAGCTCAGGGAAAATGGACGTATTCAGAGAGTGTTTGT
Motif Score 3.616982143
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000612899.5; ENST00000237289.8; ENST00000620204.3; ENST00000615468.4
External Link RMBase: m6A_site_735423
mod ID: M6ASITE077457 Click to Show/Hide the Full List
mod site chr6:137881892-137881893:+ [5]
Sequence GCCCGGTTCCTTTCCTGAGGACCCGGCAGAAATGCAGAACC
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; H1A; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000237289.8; ENST00000620204.3; ENST00000615468.4; ENST00000612899.5
External Link RMBase: m6A_site_735424
mod ID: M6ASITE077458 Click to Show/Hide the Full List
mod site chr6:137881910-137881911:+ [5]
Sequence GGACCCGGCAGAAATGCAGAACCATCCATGGACTGTGATTC
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1B; H1A; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000612899.5; ENST00000237289.8; ENST00000620204.3; ENST00000615468.4
External Link RMBase: m6A_site_735425
mod ID: M6ASITE077459 Click to Show/Hide the Full List
mod site chr6:137881921-137881922:+ [5]
Sequence AAATGCAGAACCATCCATGGACTGTGATTCTGAGGCTGCTG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1B; H1A; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000612899.5; ENST00000615468.4; ENST00000237289.8; ENST00000620204.3
External Link RMBase: m6A_site_735426
mod ID: M6ASITE077460 Click to Show/Hide the Full List
mod site chr6:137881944-137881945:+ [5]
Sequence GTGATTCTGAGGCTGCTGAGACTGAACATGTTCACATTGAC
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1B; H1A; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000237289.8; ENST00000615468.4; ENST00000612899.5; ENST00000620204.3
External Link RMBase: m6A_site_735427
mod ID: M6ASITE077461 Click to Show/Hide the Full List
mod site chr6:137881949-137881950:+ [5]
Sequence TCTGAGGCTGCTGAGACTGAACATGTTCACATTGACAGAAA
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1B; H1A; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000237289.8; ENST00000612899.5; ENST00000615468.4; ENST00000620204.3
External Link RMBase: m6A_site_735428
mod ID: M6ASITE077462 Click to Show/Hide the Full List
mod site chr6:137881971-137881972:+ [5]
Sequence ATGTTCACATTGACAGAAAAACAAGCTGCTCTTTATAATAT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; H1B; H1A; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000237289.8; ENST00000620204.3; ENST00000612899.5; ENST00000615468.4
External Link RMBase: m6A_site_735429
mod ID: M6ASITE077463 Click to Show/Hide the Full List
mod site chr6:137882081-137882082:+ [5]
Sequence TTCTAAAGAAGTTAGCTTGAACTGAGGAGTAAAAGTGTGTA
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; GM12878; LCLs; Huh7; iSLK; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000237289.8; ENST00000612899.5; ENST00000615468.4; ENST00000620204.3
External Link RMBase: m6A_site_735430
mod ID: M6ASITE077464 Click to Show/Hide the Full List
mod site chr6:137882325-137882326:+ [6]
Sequence CTTTATTTATTTTATTACAAACTTCAAGATTATTTAAGTGA
Motif Score 2.627720238
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000237289.8; ENST00000615468.4; ENST00000620204.3; ENST00000612899.5
External Link RMBase: m6A_site_735431
mod ID: M6ASITE077465 Click to Show/Hide the Full List
mod site chr6:137882395-137882396:+ [6]
Sequence CACAGTGTTCTCCTGAGAGAACATCCTTGCTTTGAGTCAGG
Motif Score 2.951386905
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000620204.3; ENST00000237289.8; ENST00000615468.4; ENST00000612899.5
External Link RMBase: m6A_site_735432
mod ID: M6ASITE077466 Click to Show/Hide the Full List
mod site chr6:137882550-137882551:+ [8]
Sequence TTCGTGCTTCTCCTTATGAAACTCCAGCTATGTAATAAAAA
Motif Score 2.627720238
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000620204.3; ENST00000615468.4; ENST00000612899.5; ENST00000237289.8
External Link RMBase: m6A_site_735433
mod ID: M6ASITE077467 Click to Show/Hide the Full List
mod site chr6:137882571-137882572:+ [8]
Sequence CTCCAGCTATGTAATAAAAAACTATACTCTGTGTTCTGTTA
Motif Score 2.627720238
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000615468.4; ENST00000620204.3; ENST00000237289.8; ENST00000612899.5
External Link RMBase: m6A_site_735434
mod ID: M6ASITE077468 Click to Show/Hide the Full List
mod site chr6:137882764-137882765:+ [6]
Sequence CATGGTACCCTGGTATTGGGACAGCAAAAGCCAGTAACCAT
Motif Score 3.643047619
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000612899.5; ENST00000237289.8
External Link RMBase: m6A_site_735435
mod ID: M6ASITE077469 Click to Show/Hide the Full List
mod site chr6:137883068-137883069:+ [9]
Sequence TTTCCAAAGATACCAAATAAACTTCAGTGTTTTCATCTAAT
Motif Score 2.627720238
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000237289.8; ENST00000612899.5
External Link RMBase: m6A_site_735436