m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00498)

Target Name	Solute carrier family 40 member 1 (FPN1)
Synonyms	Ferroportin-1; Iron-regulated transporter 1 Click to Show/Hide
Gene Name	FPN1
Chromosomal Location	2q32.2
Family	Ferroportin (FP) (TC 2.A.100) family, SLC40A subfamily
Function	Major iron transporter that plays a key role in balancing cellular and systemic iron levels. Transports iron from intestinal, splenic, and hepatic cells into the blood to provide iron to other tissues (By similarity). Controls therefore dietary iron uptake, iron recycling by macrophages, and release of iron stores in hepatocytes (By similarity). When iron is in excess, hepcidin/HAMP levels increase resulting in a degradation of ferroportin/SLC40A1 limiting the iron efflux to plasma. Click to Show/Hide
Gene ID	30061
Uniprot ID	S40A1_HUMAN
HGNC ID	HGNC:10909
KEGG ID	hsa:30061

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

FPN1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: shMETTL14 HepG2 cells Control: shCtrl HepG2 cells		GSE121949
Regulation		logFC: 1.09E+00 p-value: 8.51E-14
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Pertuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Trastuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Tucatinib		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Pertuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Trastuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Tucatinib		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Pertuzumab [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Trastuzumab [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Tucatinib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-hypomethylation regulated FGFR4 phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/Solute carrier family 40 member 1 (FPN1) signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 9 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02208		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Trastuzumab	Drug Info
Crosstalk ID: M6ACROT02213		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Pertuzumab	Drug Info
Crosstalk ID: M6ACROT02221		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Tucatinib	Drug Info
Crosstalk ID: M6ACROT02232		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Trastuzumab	Drug Info
Crosstalk ID: M6ACROT02237		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Pertuzumab	Drug Info
Crosstalk ID: M6ACROT02245		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Tucatinib	Drug Info
Crosstalk ID: M6ACROT02256		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Trastuzumab	Drug Info
Crosstalk ID: M6ACROT02261		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Pertuzumab	Drug Info
Crosstalk ID: M6ACROT02269		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Tucatinib	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00498)

Solute carrier family 40 member 1 (FPN1)

N6-methyladenosine (m6A)

In total 21 m6A sequence/site(s) in this target gene
mod ID: M6ASITE049135		Click to Show/Hide the Full List
mod site	chr2:189560666-189560667:-		[2]
Sequence	ATCCTTTGCTTCATCTTTCTACAGTATGACATAATGATTTG
Motif Score	2.078666667
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503544
mod ID: M6ASITE049136		Click to Show/Hide the Full List
mod site	chr2:189561235-189561236:-		[2]
Sequence	TGAAGCATATGTAGCACTTCACAGCATGGTTATCATGTAAG
Motif Score	2.047297619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503545
mod ID: M6ASITE049137		Click to Show/Hide the Full List
mod site	chr2:189561769-189561770:-		[2]
Sequence	TGTTTTGCTCTGTTTTTACCACAGCTGTGCCTTGAGAACTA
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503546
mod ID: M6ASITE049138		Click to Show/Hide the Full List
mod site	chr2:189562094-189562095:-		[3]
Sequence	TGGTGTACAGAACTCCATGAACTATCTTCTTGATCTTCTGC
Motif Score	3.373380952
Cell/Tissue List	HEK293T; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503547
mod ID: M6ASITE049139		Click to Show/Hide the Full List
mod site	chr2:189562103-189562104:-
Sequence	CATTATAAATGGTGTACAGAACTCCATGAACTATCTTCTTG
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503548
mod ID: M6ASITE049140		Click to Show/Hide the Full List
mod site	chr2:189562108-189562109:-		[2]
Sequence	AGAGGCATTATAAATGGTGTACAGAACTCCATGAACTATCT
Motif Score	2.856142857
Cell/Tissue List	brain; liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503549
mod ID: M6ASITE049141		Click to Show/Hide the Full List
mod site	chr2:189563789-189563790:-		[4]
Sequence	CATGCCTGGAAGCCCCCTGGACTTGTCCGTTTCTCCTTTTG
Motif Score	4.065041667
Cell/Tissue List	HepG2; HEK293T; A549; U2OS; fibroblasts; Huh7; iSLK; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503550
mod ID: M6ASITE049142		Click to Show/Hide the Full List
mod site	chr2:189563848-189563849:-		[2]
Sequence	GGTCTGATCTCAGGATTGGCACAGCTTTCCTGTTTGATCTT
Motif Score	2.830589286
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503551
mod ID: M6ASITE049143		Click to Show/Hide the Full List
mod site	chr2:189563871-189563872:-		[4]
Sequence	GAAAATGTGGTTTGGTTCGGACAGGTCTGATCTCAGGATTG
Motif Score	3.643047619
Cell/Tissue List	HepG2; HEK293T; liver; A549; U2OS; fibroblasts; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503552
mod ID: M6ASITE049144		Click to Show/Hide the Full List
mod site	chr2:189563916-189563917:-		[5]
Sequence	CTATAACTGGAATAATGGGAACTGTAGCTTTTACTTGGCTA
Motif Score	3.373380952
Cell/Tissue List	CD34; HepG2; HEK293T; A549; U2OS; fibroblasts; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503553
mod ID: M6ASITE049145		Click to Show/Hide the Full List
mod site	chr2:189563931-189563932:-		[6]
Sequence	TGATGGGAGCATCAGCTATAACTGGAATAATGGGAACTGTA
Motif Score	2.590089286
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503554
mod ID: M6ASITE049146		Click to Show/Hide the Full List
mod site	chr2:189563977-189563978:-		[5]
Sequence	GGGTACGCCTACACTCAGGGACTGAGTGGTTCCATCCTCAG
Motif Score	4.065041667
Cell/Tissue List	CD34; HepG2; HEK293T; A549; U2OS; fibroblasts; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503555
mod ID: M6ASITE049147		Click to Show/Hide the Full List
mod site	chr2:189564011-189564012:-		[6]
Sequence	TATGACTGTCCTGGGCTTTGACTGCATCACCACAGGGTACG
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503556
mod ID: M6ASITE049148		Click to Show/Hide the Full List
mod site	chr2:189564027-189564028:-		[6]
Sequence	GTCTTGCTTTCCTTTATATGACTGTCCTGGGCTTTGACTGC
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503557
mod ID: M6ASITE049149		Click to Show/Hide the Full List
mod site	chr2:189564154-189564155:-		[7]
Sequence	TCTAACATCCATGAGCTTGAACATGAGCAAGAGCCTACTTG
Motif Score	2.951386905
Cell/Tissue List	HEK293T; A549; U2OS; fibroblasts; Jurkat; HEK293A-TOA; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503558
mod ID: M6ASITE049150		Click to Show/Hide the Full List
mod site	chr2:189564176-189564177:-		[7]
Sequence	TCATCTAATGGGTGTGAAAGACTCTAACATCCATGAGCTTG
Motif Score	3.319380952
Cell/Tissue List	HEK293T; A549; U2OS; fibroblasts; Jurkat; HEK293A-TOA; endometrial
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503559
mod ID: M6ASITE049151		Click to Show/Hide the Full List
mod site	chr2:189564198-189564199:-		[7]
Sequence	AGCCAAAACCCCTGGAGGGAACTCATCTAATGGGTGTGAAA
Motif Score	3.373380952
Cell/Tissue List	HEK293T; A549; U2OS; fibroblasts; HEK293A-TOA; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503560
mod ID: M6ASITE049152		Click to Show/Hide the Full List
mod site	chr2:189564211-189564212:-		[8]
Sequence	TTAACAGATACTGAGCCAAAACCCCTGGAGGGAACTCATCT
Motif Score	2.185083333
Cell/Tissue List	HEK293T; U2OS; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503561
mod ID: M6ASITE049153		Click to Show/Hide the Full List
mod site	chr2:189565372-189565373:-		[8]
Sequence	GAAGAGGAAACTGAATTGAAACAGCTGAATTTACACAAAGG
Motif Score	2.20572619
Cell/Tissue List	U2OS; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503562
mod ID: M6ASITE049154		Click to Show/Hide the Full List
mod site	chr2:189565383-189565384:-		[8]
Sequence	CTGGTCTTAAAGAAGAGGAAACTGAATTGAAACAGCTGAAT
Motif Score	2.627720238
Cell/Tissue List	U2OS; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000261024.6
External Link	RMBase: m6A_site_503563
mod ID: M6ASITE049155		Click to Show/Hide the Full List
mod site	chr2:189571731-189571732:-		[2]
Sequence	TGTTGTTGTTGCAGGAGAAGACAGAAGCAAACTAGCAAGTA
Motif Score	2.897386905
Cell/Tissue List	kidney; liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000427241.5; ENST00000261024.6
External Link	RMBase: m6A_site_503564

Ref 1	N6-methyladenosine regulated FGFR4 attenuates ferroptotic cell death in recalcitrant HER2-positive breast cancer. Nat Commun. 2022 May 13;13(1):2672. doi: 10.1038/s41467-022-30217-7.
Ref 2	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 3	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 4	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 5	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 6	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 7	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 8	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map