General Information of the m6A Target Gene (ID: M6ATAR00469)
Target Name Hepatitis A virus cellular receptor 1 (HAVCR1)
Gene Name HAVCR1
Chromosomal Location 5q33.3
Family immunoglobulin superfamily. TIM family. {ECO:0000305}.
Function
Phosphatidylserine receptor that plays an important functional role in regulatory B-cells homeostasis including generation, expansion and suppressor functions (By similarity). As P-selectin/SELPLG ligand, plays a specialized role in activated but not naive T-cell trafficking during inflammatory responses. Controls thereby T-cell accumulation in the inflamed central nervous system (CNS) and the induction of autoimmune disease. Regulates also expression of various anti-inflammatory cytokines and co-inhibitory ligands including IL10 (By similarity). Acts as regulator of T-cell proliferation (By similarity). May play a role in kidney injury and repair ; (Microbial infection) Acts as a receptor for Hepatitis A virus; (Microbial infection) Acts as a receptor for Ebolavirus and Marburg virus by binding exposed phosphatidyl-serine at the surface of virion membrane. Serves as a dual receptor for Ebolavirus by also interacting with envelope glycoprotein GP; (Microbial infection) Acts as a receptor for Dengue virus by binding exposed phosphatidyl-serine at the surface of virion membrane. TIM1 and Dengue virus are co-internalized during virus entry; (Microbial infection) Acts as a receptor for Zika virus by binding to envelope protein E.
    Click to Show/Hide
Gene ID 3014
Uniprot ID
HAVR1_HUMAN
HGNC ID
HGNC:17866
KEGG ID
hsa:26762
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HAVCR1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Disease
Browse Drug
Acute kidney failure [ICD-11: GB60]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in FGA and Hepatitis A virus cellular receptor 1 (HAVCR1) protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Responsed Drug Cisplatin Approved
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Experiment 2 Reporting the m6A-centered Disease Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in FGA and Hepatitis A virus cellular receptor 1 (HAVCR1) protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Responsed Drug Berberine Phase 4
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Cisplatin [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in FGA and Hepatitis A virus cellular receptor 1 (HAVCR1) protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure ICD-11: GB60
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Berberine [Phase 4]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in FGA and Hepatitis A virus cellular receptor 1 (HAVCR1) protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure ICD-11: GB60
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00469)
Hepatitis A virus cellular receptor 1 (HAVCR1)
5-methylcytidine (m5C)
In total 19 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003659 Click to Show/Hide the Full List
mod site chr5:157036209-157036210:-
Sequence CTGGGATTACAGGCATGAGCCACCACGCCCGGCCGAATTTT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000625904.2; ENST00000523175.5; ENST00000517644.1; ENST00000339252.7; ENST00000522693.5
External Link RMBase: m5C_site_36231
mod ID: M5CSITE003660 Click to Show/Hide the Full List
mod site chr5:157036210-157036211:-
Sequence GCTGGGATTACAGGCATGAGCCACCACGCCCGGCCGAATTT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000522693.5; ENST00000517644.1; ENST00000625904.2; ENST00000339252.7; ENST00000523175.5
External Link RMBase: m5C_site_36232
mod ID: M5CSITE003661 Click to Show/Hide the Full List
mod site chr5:157036216-157036217:-
Sequence CAAAGTGCTGGGATTACAGGCATGAGCCACCACGCCCGGCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000523175.5; ENST00000517644.1; ENST00000625904.2; ENST00000522693.5; ENST00000339252.7
External Link RMBase: m5C_site_36233
mod ID: M5CSITE003662 Click to Show/Hide the Full List
mod site chr5:157036220-157036221:-
Sequence CTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACGCCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000523175.5; ENST00000517644.1; ENST00000339252.7; ENST00000522693.5; ENST00000625904.2
External Link RMBase: m5C_site_36234
mod ID: M5CSITE003663 Click to Show/Hide the Full List
mod site chr5:157036229-157036230:-
Sequence TGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000523175.5; ENST00000339252.7; ENST00000625904.2; ENST00000517644.1; ENST00000522693.5
External Link RMBase: m5C_site_36235
mod ID: M5CSITE003664 Click to Show/Hide the Full List
mod site chr5:157037272-157037273:-
Sequence TTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATCATTG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000625904.2; ENST00000517644.1; ENST00000339252.7; ENST00000522693.5; ENST00000523175.5
External Link RMBase: m5C_site_36236
mod ID: M5CSITE003665 Click to Show/Hide the Full List
mod site chr5:157037276-157037277:-
Sequence GTATTTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000522693.5; ENST00000523175.5; ENST00000625904.2; ENST00000339252.7; ENST00000517644.1
External Link RMBase: m5C_site_36237
mod ID: M5CSITE003666 Click to Show/Hide the Full List
mod site chr5:157037290-157037291:-
Sequence CTATGCTGGAGTCTGTATTTCTGTCTTGGTGCTTCTTGCTC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000522693.5; ENST00000339252.7; ENST00000517644.1; ENST00000523175.5; ENST00000625904.2
External Link RMBase: m5C_site_36238
mod ID: M5CSITE003667 Click to Show/Hide the Full List
mod site chr5:157037298-157037299:-
Sequence AAAGGAATCTATGCTGGAGTCTGTATTTCTGTCTTGGTGCT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000625904.2; ENST00000522693.5; ENST00000339252.7; ENST00000517644.1; ENST00000523175.5
External Link RMBase: m5C_site_36239
mod ID: M5CSITE003668 Click to Show/Hide the Full List
mod site chr5:157037322-157037323:-
Sequence AGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTGG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000523175.5; ENST00000339252.7; ENST00000625904.2; ENST00000522693.5; ENST00000517644.1
External Link RMBase: m5C_site_36240
mod ID: M5CSITE003669 Click to Show/Hide the Full List
mod site chr5:157037323-157037324:-
Sequence TAGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000517644.1; ENST00000339252.7; ENST00000522693.5; ENST00000523175.5; ENST00000625904.2
External Link RMBase: m5C_site_36241
mod ID: M5CSITE003670 Click to Show/Hide the Full List
mod site chr5:157037328-157037329:-
Sequence GAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCTA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000625904.2; ENST00000339252.7; ENST00000517644.1; ENST00000523175.5; ENST00000522693.5
External Link RMBase: m5C_site_36242
mod ID: M5CSITE003671 Click to Show/Hide the Full List
mod site chr5:157037329-157037330:-
Sequence AGAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000522693.5; ENST00000339252.7; ENST00000625904.2; ENST00000523175.5; ENST00000517644.1
External Link RMBase: m5C_site_36243
mod ID: M5CSITE003672 Click to Show/Hide the Full List
mod site chr5:157037332-157037333:-
Sequence CCTAGAACATAGTCTACTGACGGCCAATACCACTAAAGGAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000339252.7; ENST00000522693.5; ENST00000625904.2; ENST00000517644.1; ENST00000523175.5
External Link RMBase: m5C_site_36244
mod ID: M5CSITE003673 Click to Show/Hide the Full List
mod site chr5:157037336-157037337:-
Sequence TGTTCCTAGAACATAGTCTACTGACGGCCAATACCACTAAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000523175.5; ENST00000517644.1; ENST00000339252.7; ENST00000625904.2; ENST00000522693.5
External Link RMBase: m5C_site_36245
mod ID: M5CSITE003674 Click to Show/Hide the Full List
mod site chr5:157037352-157037353:-
Sequence TTGTTTCCTCAGCAACTGTTCCTAGAACATAGTCTACTGAC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000625904.2; ENST00000517644.1; ENST00000339252.7; ENST00000523175.5; ENST00000522693.5
External Link RMBase: m5C_site_36246
mod ID: M5CSITE003675 Click to Show/Hide the Full List
mod site chr5:157037360-157037361:-
Sequence ATCTGTTGTTGTTTCCTCAGCAACTGTTCCTAGAACATAGT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000522693.5; ENST00000517644.1; ENST00000523175.5; ENST00000625904.2; ENST00000339252.7
External Link RMBase: m5C_site_36247
mod ID: M5CSITE003676 Click to Show/Hide the Full List
mod site chr5:157042627-157042628:-
Sequence CCTTTGGAATAACAATCAAACTGTAAGCATATTCCGCCCTA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000625904.2; ENST00000517644.1; ENST00000522693.5; ENST00000339252.7; ENST00000523175.5
External Link RMBase: m5C_site_36248
mod ID: M5CSITE003677 Click to Show/Hide the Full List
mod site chr5:157042631-157042632:-
Sequence ATGGCCTTTGGAATAACAATCAAACTGTAAGCATATTCCGC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000517644.1; ENST00000625904.2; ENST00000339252.7; ENST00000522693.5; ENST00000523175.5
External Link RMBase: m5C_site_36249
N6-methyladenosine (m6A)
In total 21 m6A sequence/site(s) in this target gene
mod ID: M6ASITE072390 Click to Show/Hide the Full List
mod site chr5:157029442-157029443:- [1]
Sequence TAATTGTATGTTCTTTTTAGACCCCATAAATCCTGTATACA
Motif Score 2.876744048
Cell/Tissue List A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523175.5; ENST00000522693.5
External Link RMBase: m6A_site_695270
mod ID: M6ASITE072391 Click to Show/Hide the Full List
mod site chr5:157029470-157029471:- [1]
Sequence CAGTTTTCTCTCAAATATGAACACTTTATAATTGTATGTTC
Motif Score 2.951386905
Cell/Tissue List A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523175.5; ENST00000522693.5
External Link RMBase: m6A_site_695271
mod ID: M6ASITE072392 Click to Show/Hide the Full List
mod site chr5:157029515-157029516:- [2]
Sequence TCCTAATTTTTTATGCTAAAACTGGCTCAATCCTTCTGATC
Motif Score 2.627720238
Cell/Tissue List A549; Huh7; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000522693.5; ENST00000523175.5; ENST00000339252.7
External Link RMBase: m6A_site_695272
mod ID: M6ASITE072393 Click to Show/Hide the Full List
mod site chr5:157029567-157029568:- [2]
Sequence GAGTAACTCTCTCACTCCAAACTGTGTATAGTCAACCTCAT
Motif Score 2.627720238
Cell/Tissue List A549; Huh7; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000523175.5; ENST00000522693.5; ENST00000339252.7; ENST00000625904.2
External Link RMBase: m6A_site_695273
mod ID: M6ASITE072394 Click to Show/Hide the Full List
mod site chr5:157029643-157029644:- [2]
Sequence GACGTCTTTTAGACCCCAAGACAATTTTTCTGTTTCAGTTT
Motif Score 2.897386905
Cell/Tissue List A549; Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000522693.5; ENST00000625904.2; ENST00000523175.5; ENST00000339252.7
External Link RMBase: m6A_site_695274
mod ID: M6ASITE072395 Click to Show/Hide the Full List
mod site chr5:157029651-157029652:- [2]
Sequence GCACATCAGACGTCTTTTAGACCCCAAGACAATTTTTCTGT
Motif Score 2.876744048
Cell/Tissue List A549; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000523175.5; ENST00000522693.5; ENST00000339252.7; ENST00000625904.2
External Link RMBase: m6A_site_695275
mod ID: M6ASITE072396 Click to Show/Hide the Full List
mod site chr5:157029677-157029678:- [2]
Sequence GAGTGCAGAAGACTGAACAGACATCAGCACATCAGACGTCT
Motif Score 2.897386905
Cell/Tissue List A549; hESC-HEK293T; iSLK; HEC-1-A
Seq Type List MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; m6A-seq
Transcript ID List ENST00000522693.5; ENST00000339252.7; ENST00000523175.5; ENST00000625904.2
External Link RMBase: m6A_site_695276
mod ID: M6ASITE072397 Click to Show/Hide the Full List
mod site chr5:157029681-157029682:- [1]
Sequence CCATGAGTGCAGAAGACTGAACAGACATCAGCACATCAGAC
Motif Score 2.951386905
Cell/Tissue List A549; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000522693.5; ENST00000625904.2; ENST00000339252.7; ENST00000523175.5
External Link RMBase: m6A_site_695277
mod ID: M6ASITE072398 Click to Show/Hide the Full List
mod site chr5:157029686-157029687:- [1]
Sequence TACGCCCATGAGTGCAGAAGACTGAACAGACATCAGCACAT
Motif Score 3.319380952
Cell/Tissue List A549; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000522693.5; ENST00000523175.5; ENST00000625904.2; ENST00000339252.7
External Link RMBase: m6A_site_695278
mod ID: M6ASITE072399 Click to Show/Hide the Full List
mod site chr5:157029730-157029731:- [1]
Sequence TCTTTATGCCACGGACTAAGACCCAGTGGTGCTCTTTGAGA
Motif Score 2.876744048
Cell/Tissue List A549; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000339252.7; ENST00000523175.5; ENST00000522693.5; ENST00000625904.2
External Link RMBase: m6A_site_695279
mod ID: M6ASITE072400 Click to Show/Hide the Full List
mod site chr5:157029736-157029737:- [1]
Sequence GAATAGTCTTTATGCCACGGACTAAGACCCAGTGGTGCTCT
Motif Score 4.065041667
Cell/Tissue List A549; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000625904.2; ENST00000339252.7; ENST00000522693.5; ENST00000523175.5
External Link RMBase: m6A_site_695280
mod ID: M6ASITE072401 Click to Show/Hide the Full List
mod site chr5:157029772-157029773:- [1]
Sequence AAAGGAAGTCCAAGCAGAAGACAATATCTACATTGAGAATA
Motif Score 2.897386905
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000517644.1; ENST00000523175.5; ENST00000339252.7; ENST00000522693.5; ENST00000625904.2
External Link RMBase: m6A_site_695281
mod ID: M6ASITE072402 Click to Show/Hide the Full List
mod site chr5:157042628-157042629:- [3]
Sequence GCCTTTGGAATAACAATCAAACTGTAAGCATATTCCGCCCT
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000339252.7; ENST00000522693.5; ENST00000625904.2; ENST00000517644.1; ENST00000523175.5
External Link RMBase: m6A_site_695282
mod ID: M6ASITE072403 Click to Show/Hide the Full List
mod site chr5:157049071-157049072:- [3]
Sequence CAGGGAGCAATAAGGAGAGAACCCACCAGCTCACCATTGTA
Motif Score 2.930744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000625904.2; ENST00000339252.7; ENST00000522693.5; ENST00000523175.5; ENST00000517644.1
External Link RMBase: m6A_site_695283
mod ID: M6ASITE072404 Click to Show/Hide the Full List
mod site chr5:157049109-157049110:- [3]
Sequence CTTCACCTCAGCCAGCAGAAACCCACCCTACGACACTGCAG
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000523175.5; ENST00000625904.2; ENST00000522693.5; ENST00000517644.1; ENST00000339252.7
External Link RMBase: m6A_site_695284
mod ID: M6ASITE072405 Click to Show/Hide the Full List
mod site chr5:157052364-157052365:- [3]
Sequence TTGCCCAGGCAGAACCATGAACCAGGTAAAACAGATGTGTT
Motif Score 2.930744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000523175.5; ENST00000522693.5; ENST00000518745.1; ENST00000339252.7; ENST00000625904.2
External Link RMBase: m6A_site_695285
mod ID: M6ASITE072406 Click to Show/Hide the Full List
mod site chr5:157052371-157052372:- [3]
Sequence AATGCCTTTGCCCAGGCAGAACCATGAACCAGGTAAAACAG
Motif Score 2.930744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000339252.7; ENST00000518745.1; ENST00000625904.2; ENST00000522693.5; ENST00000523175.5
External Link RMBase: m6A_site_695286
mod ID: M6ASITE072407 Click to Show/Hide the Full List
mod site chr5:157055334-157055335:- [2]
Sequence ACGCTATAAGCTATTGGGGGACCTTTCAAGAAGGGATGTCT
Motif Score 3.622404762
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000339252.7; ENST00000522693.5; ENST00000518745.1; ENST00000625904.2; ENST00000523175.5
External Link RMBase: m6A_site_695287
mod ID: M6ASITE072408 Click to Show/Hide the Full List
mod site chr5:157055358-157055359:- [2]
Sequence CCACGTCACCTATCGGAAGGACACACGCTATAAGCTATTGG
Motif Score 3.643047619
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000625904.2; ENST00000518745.1; ENST00000522693.5; ENST00000523175.5; ENST00000339252.7
External Link RMBase: m6A_site_695288
mod ID: M6ASITE072409 Click to Show/Hide the Full List
mod site chr5:157055380-157055381:- [2]
Sequence GCATTGTCTGGACCAATGGAACCCACGTCACCTATCGGAAG
Motif Score 2.930744048
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000518745.1; ENST00000522693.5; ENST00000625904.2; ENST00000523175.5; ENST00000339252.7
External Link RMBase: m6A_site_695289
mod ID: M6ASITE072410 Click to Show/Hide the Full List
mod site chr5:157055389-157055390:- [2]
Sequence GCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTCACC
Motif Score 3.622404762
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000625904.2; ENST00000523175.5; ENST00000339252.7; ENST00000522693.5; ENST00000518745.1
External Link RMBase: m6A_site_695290