m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00468)
Target Name Fibrinogen alpha chain (FGA)
Gene Name FGA
Chromosomal Location 4q31.3
Function
Cleaved by the protease thrombin to yield monomers which, together with fibrinogen beta (FGB) and fibrinogen gamma (FGG), polymerize to form an insoluble fibrin matrix. Fibrin has a major function in hemostasis as one of the primary components of blood clots. In addition, functions during the early stages of wound repair to stabilize the lesion and guide cell migration during re-epithelialization. Was originally thought to be essential for platelet aggregation, based on in vitro studies using anticoagulated blood. However, subsequent studies have shown that it is not absolutely required for thrombus formation in vivo. Enhances expression of SELP in activated platelets via an ITGB3-dependent pathway. Maternal fibrinogen is essential for successful pregnancy. Fibrin deposition is also associated with infection, where it protects against IFNG-mediated hemorrhage. May also facilitate the immune response via both innate and T-cell mediated pathways. {ECO:0000250|UniProtKB:E9PV24}.
    Click to Show/Hide
Gene ID 9575
Uniprot ID
FIBA_HUMAN
HGNC ID
HGNC:3661
KEGG ID
hsa:2243
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
FGA can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Disease
Browse Drug
Acute kidney failure [ICD-11: GB60]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in Fibrinogen alpha chain (FGA) and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Responsed Drug Cisplatin Approved
 Drug Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Experiment 2 Reporting the m6A-centered Disease Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in Fibrinogen alpha chain (FGA) and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Responsed Drug Berberine Phase 4
 Drug Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Cisplatin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in Fibrinogen alpha chain (FGA) and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Berberine [Phase 4]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Slc12a1 protein levels and a decrease in Fibrinogen alpha chain (FGA) and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00468)
Fibrinogen alpha chain (FGA)
N6-methyladenosine (m6A)
In total 56 m6A sequence/site(s) in this target gene
mod ID: M6ASITE068497 Click to Show/Hide the Full List
mod site chr4:154583359-154583360:- [1]
Sequence CATTTTTCTAATAATCATAAACTATATTCTGTGACATGCTA
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654964
mod ID: M6ASITE068498 Click to Show/Hide the Full List
mod site chr4:154583406-154583407:- [1]
Sequence CATAATTCACACATTAATAAACAATCTCCCAAGTATTGATT
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_654965
mod ID: M6ASITE068499 Click to Show/Hide the Full List
mod site chr4:154583427-154583428:- [1]
Sequence TTTATGAATATTAAAAAAAGACATAATTCACACATTAATAA
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654966
mod ID: M6ASITE068500 Click to Show/Hide the Full List
mod site chr4:154583451-154583452:- [1]
Sequence AACACATTTAAAATTTTAAAACTATTTATGAATATTAAAAA
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654967
mod ID: M6ASITE068501 Click to Show/Hide the Full List
mod site chr4:154583470-154583471:- [1]
Sequence GTAACCAATTTCTTTCTAAAACACATTTAAAATTTTAAAAC
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_654968
mod ID: M6ASITE068502 Click to Show/Hide the Full List
mod site chr4:154583537-154583538:- [1]
Sequence AATGAAAATCTATCCTTTAAACTCTTCCACTAGACGTTGTA
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654969
mod ID: M6ASITE068503 Click to Show/Hide the Full List
mod site chr4:154583576-154583577:- [1]
Sequence AATCCAGGAAGGCAAGAGAAACATTCTTTCCTAAATATAAA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654970
mod ID: M6ASITE068504 Click to Show/Hide the Full List
mod site chr4:154584331-154584332:- [1]
Sequence TGCAGACCAGTGGGAAGAGAACTGTGCAGAAGTCTATGGGG
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654971
mod ID: M6ASITE068505 Click to Show/Hide the Full List
mod site chr4:154584346-154584347:- [1]
Sequence CACCTTTGACAGGGATGCAGACCAGTGGGAAGAGAACTGTG
Motif Score 2.876744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654972
mod ID: M6ASITE068506 Click to Show/Hide the Full List
mod site chr4:154584535-154584536:- [2]
Sequence TCTTAGGGTTGAATTAGAGGACTGGGCTGGGAATGAAGCTT
Motif Score 4.065041667
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_654973
mod ID: M6ASITE068507 Click to Show/Hide the Full List
mod site chr4:154584652-154584653:- [2]
Sequence TTTTAACCGGACCTGGCAAGACTACAAGAGAGGTTTCGGCA
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654974
mod ID: M6ASITE068508 Click to Show/Hide the Full List
mod site chr4:154584662-154584663:- [2]
Sequence GATCACTGAATTTTAACCGGACCTGGCAAGACTACAAGAGA
Motif Score 3.622404762
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654975
mod ID: M6ASITE068509 Click to Show/Hide the Full List
mod site chr4:154584725-154584726:- [3]
Sequence CTGTTTATTGCGATCAAGAGACCAGTTTGGGAGGATGGCTT
Motif Score 2.876744048
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654976
mod ID: M6ASITE068510 Click to Show/Hide the Full List
mod site chr4:154584812-154584813:- [1]
Sequence ACTGTGATGATGTCCTCCAAACACATCCTTCAGGTACCCAA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_654977
mod ID: M6ASITE068511 Click to Show/Hide the Full List
mod site chr4:154585582-154585583:- [1]
Sequence GTGAAGCCGATCATGAAGGAACACATAGCACCAAGAGAGGC
Motif Score 2.951386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_654978
mod ID: M6ASITE068512 Click to Show/Hide the Full List
mod site chr4:154585650-154585651:- [4]
Sequence CACGAGTTACAACAGAGGAGACTCCACATTTGAAAGCAAGA
Motif Score 3.319380952
Cell/Tissue List A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000622532.1; ENST00000302053.7; ENST00000651975.1; ENST00000403106.8
External Link RMBase: m6A_site_654979
mod ID: M6ASITE068513 Click to Show/Hide the Full List
mod site chr4:154585685-154585686:- [4]
Sequence AAATCTTCAAGTTACAGCAAACAATTTACTAGTAGCACGAG
Motif Score 2.20572619
Cell/Tissue List A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000622532.1; ENST00000403106.8; ENST00000302053.7
External Link RMBase: m6A_site_654980
mod ID: M6ASITE068514 Click to Show/Hide the Full List
mod site chr4:154585798-154585799:- [2]
Sequence TAGGAGAGTTTGTCAGTGAGACTGAGTCTAGGGGCTCAGAA
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000651975.1; ENST00000622532.1; ENST00000403106.8
External Link RMBase: m6A_site_654981
mod ID: M6ASITE068515 Click to Show/Hide the Full List
mod site chr4:154585846-154585847:- [2]
Sequence ACACTGCCTCAACTGGAAAAACATTCCCAGGTTTCTTCTCA
Motif Score 2.20572619
Cell/Tissue List HepG2; liver; A549; Huh7
Seq Type List m6A-seq; m6A-REF-seq; MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000651975.1; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_654982
mod ID: M6ASITE068516 Click to Show/Hide the Full List
mod site chr4:154586026-154586027:- [2]
Sequence GCTCTAAAACCGTTACTAAGACTGTTATTGGTCCTGATGGT
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000403106.8; ENST00000622532.1; ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654983
mod ID: M6ASITE068517 Click to Show/Hide the Full List
mod site chr4:154586038-154586039:- [2]
Sequence CGCGTCGTTCATGCTCTAAAACCGTTACTAAGACTGTTATT
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000622532.1; ENST00000302053.7; ENST00000403106.8; ENST00000651975.1
External Link RMBase: m6A_site_654984
mod ID: M6ASITE068518 Click to Show/Hide the Full List
mod site chr4:154586098-154586099:- [2]
Sequence AAGGAGATAAAGAGCTCAGGACTGGTAAAGAGAAGGTCACC
Motif Score 4.065041667
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000622532.1; ENST00000403106.8; ENST00000651975.1; ENST00000302053.7
External Link RMBase: m6A_site_654985
mod ID: M6ASITE068519 Click to Show/Hide the Full List
mod site chr4:154586132-154586133:- [2]
Sequence AGAGAGTACCACACAGAAAAACTGGTCACTTCTAAAGGAGA
Motif Score 2.627720238
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000622532.1; ENST00000403106.8; ENST00000651975.1
External Link RMBase: m6A_site_654986
mod ID: M6ASITE068520 Click to Show/Hide the Full List
mod site chr4:154586158-154586159:- [2]
Sequence CAGGAAATGTAAGTCCAGGGACAAGGAGAGAGTACCACACA
Motif Score 3.643047619
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000622532.1; ENST00000302053.7
External Link RMBase: m6A_site_654987
mod ID: M6ASITE068521 Click to Show/Hide the Full List
mod site chr4:154586202-154586203:- [2]
Sequence CGCGAGGCCTAACAACCCAGACTGGGGCACATTTGAAGAGG
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000302053.7; ENST00000622532.1; ENST00000651975.1
External Link RMBase: m6A_site_654988
mod ID: M6ASITE068522 Click to Show/Hide the Full List
mod site chr4:154586276-154586277:- [2]
Sequence TCTGTATCTGGTAGTACTGGACAATGGCACTCTGAATCTGG
Motif Score 3.643047619
Cell/Tissue List HepG2; kidney; liver; A549; hESC-HEK293T; Huh7; iSLK
Seq Type List m6A-seq; m6A-REF-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000302053.7; ENST00000651975.1; ENST00000622532.1; ENST00000403106.8
External Link RMBase: m6A_site_654989
mod ID: M6ASITE068523 Click to Show/Hide the Full List
mod site chr4:154586308-154586309:- [2]
Sequence GCGGAAGTGCTGGGCACTGGACCTCTGAGAGCTCTGTATCT
Motif Score 3.622404762
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000651975.1; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_654990
mod ID: M6ASITE068524 Click to Show/Hide the Full List
mod site chr4:154586330-154586331:- [5]
Sequence TGGAATCCTGGCAGCTCTGAACGCGGAAGTGCTGGGCACTG
Motif Score 2.925321429
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000302053.7; ENST00000403106.8; ENST00000651975.1; ENST00000622532.1
External Link RMBase: m6A_site_654991
mod ID: M6ASITE068525 Click to Show/Hide the Full List
mod site chr4:154586353-154586354:- [2]
Sequence CTAGACCTGGTAGTACCGGAACCTGGAATCCTGGCAGCTCT
Motif Score 2.930744048
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000622532.1; ENST00000651975.1; ENST00000403106.8
External Link RMBase: m6A_site_654992
mod ID: M6ASITE068526 Click to Show/Hide the Full List
mod site chr4:154586369-154586370:- [2]
Sequence CAAAACCCTGGGAGCCCTAGACCTGGTAGTACCGGAACCTG
Motif Score 2.876744048
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000622532.1; ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_654993
mod ID: M6ASITE068527 Click to Show/Hide the Full List
mod site chr4:154586385-154586386:- [2]
Sequence TGGAAGTACTGGAAACCAAAACCCTGGGAGCCCTAGACCTG
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000651975.1; ENST00000403106.8; ENST00000622532.1
External Link RMBase: m6A_site_654994
mod ID: M6ASITE068528 Click to Show/Hide the Full List
mod site chr4:154586391-154586392:- [2]
Sequence TGGAACTGGAAGTACTGGAAACCAAAACCCTGGGAGCCCTA
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7; ENST00000403106.8; ENST00000622532.1
External Link RMBase: m6A_site_654995
mod ID: M6ASITE068529 Click to Show/Hide the Full List
mod site chr4:154586407-154586408:- [2]
Sequence GGAACTCTGGGAGCTCTGGAACTGGAAGTACTGGAAACCAA
Motif Score 3.373380952
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_654996
mod ID: M6ASITE068530 Click to Show/Hide the Full List
mod site chr4:154586424-154586425:- [2]
Sequence TGGAAGTACTGGAAGCTGGAACTCTGGGAGCTCTGGAACTG
Motif Score 3.373380952
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000651975.1; ENST00000302053.7; ENST00000622532.1; ENST00000403106.8
External Link RMBase: m6A_site_654997
mod ID: M6ASITE068531 Click to Show/Hide the Full List
mod site chr4:154586447-154586448:- [2]
Sequence TGGAAACCTGGGAGCTCTGGACCTGGAAGTACTGGAAGCTG
Motif Score 3.622404762
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000622532.1; ENST00000651975.1; ENST00000302053.7; ENST00000403106.8
External Link RMBase: m6A_site_654998
mod ID: M6ASITE068532 Click to Show/Hide the Full List
mod site chr4:154586462-154586463:- [2]
Sequence GGAGGGACTGCAACCTGGAAACCTGGGAGCTCTGGACCTGG
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_654999
mod ID: M6ASITE068533 Click to Show/Hide the Full List
mod site chr4:154586476-154586477:- [2]
Sequence GGAGCTCTGGGACTGGAGGGACTGCAACCTGGAAACCTGGG
Motif Score 4.065041667
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000302053.7; ENST00000651975.1; ENST00000403106.8; ENST00000622532.1
External Link RMBase: m6A_site_655000
mod ID: M6ASITE068534 Click to Show/Hide the Full List
mod site chr4:154586485-154586486:- [2]
Sequence GAAACCCTGGGAGCTCTGGGACTGGAGGGACTGCAACCTGG
Motif Score 4.065041667
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000403106.8; ENST00000622532.1; ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_655001
mod ID: M6ASITE068535 Click to Show/Hide the Full List
mod site chr4:154586502-154586503:- [2]
Sequence TGGAAGTACTGGAAACCGAAACCCTGGGAGCTCTGGGACTG
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_655002
mod ID: M6ASITE068536 Click to Show/Hide the Full List
mod site chr4:154586508-154586509:- [2]
Sequence TGGACCTGGAAGTACTGGAAACCGAAACCCTGGGAGCTCTG
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000622532.1; ENST00000403106.8; ENST00000302053.7
External Link RMBase: m6A_site_655003
mod ID: M6ASITE068537 Click to Show/Hide the Full List
mod site chr4:154586525-154586526:- [2]
Sequence TGGAACTCTGGGAGCTCTGGACCTGGAAGTACTGGAAACCG
Motif Score 3.622404762
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000403106.8; ENST00000622532.1; ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_655004
mod ID: M6ASITE068538 Click to Show/Hide the Full List
mod site chr4:154586541-154586542:- [2]
Sequence TAGCAGTGCTGGAAGCTGGAACTCTGGGAGCTCTGGACCTG
Motif Score 3.373380952
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000302053.7; ENST00000622532.1; ENST00000651975.1; ENST00000403106.8
External Link RMBase: m6A_site_655005
mod ID: M6ASITE068539 Click to Show/Hide the Full List
mod site chr4:154586565-154586566:- [2]
Sequence AGAGACGGAAAGCCCCAGGAACCCTAGCAGTGCTGGAAGCT
Motif Score 2.930744048
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000622532.1; ENST00000651975.1; ENST00000403106.8; ENST00000302053.7
External Link RMBase: m6A_site_655006
mod ID: M6ASITE068540 Click to Show/Hide the Full List
mod site chr4:154586593-154586594:- [2]
Sequence GAGGCTCCACCTCTTATGGAACCGGATCAGAGACGGAAAGC
Motif Score 2.930744048
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_655007
mod ID: M6ASITE068541 Click to Show/Hide the Full List
mod site chr4:154586639-154586640:- [2]
Sequence ATGAGAATGGAGTTAGAGAGACCTGGTGGAAATGAGATTAC
Motif Score 2.876744048
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000622532.1; ENST00000651975.1; ENST00000302053.7; ENST00000403106.8
External Link RMBase: m6A_site_655008
mod ID: M6ASITE068542 Click to Show/Hide the Full List
mod site chr4:154586670-154586671:- [2]
Sequence AGAGTGGAAGGCATTAACAGACATGCCGCAGATGAGAATGG
Motif Score 2.897386905
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000651975.1; ENST00000622532.1; ENST00000302053.7
External Link RMBase: m6A_site_655009
mod ID: M6ASITE068543 Click to Show/Hide the Full List
mod site chr4:154586736-154586737:- [2]
Sequence AAAAATGAAACCAGTTCCAGACTTGGTTCCCGGAAATTTTA
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000622532.1; ENST00000302053.7; ENST00000651975.1
External Link RMBase: m6A_site_655010
mod ID: M6ASITE068544 Click to Show/Hide the Full List
mod site chr4:154586747-154586748:- [2]
Sequence TTACCACTGATAAAAATGAAACCAGTTCCAGACTTGGTTCC
Motif Score 2.185083333
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_655011
mod ID: M6ASITE068545 Click to Show/Hide the Full List
mod site chr4:154586796-154586797:- [2]
Sequence TGAACAGGTCATTGCCAAAGACTTACTTCCCTCTAGAGATA
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000622532.1; ENST00000302053.7; ENST00000651975.1; ENST00000403106.8
External Link RMBase: m6A_site_655012
mod ID: M6ASITE068546 Click to Show/Hide the Full List
mod site chr4:154586813-154586814:- [2]
Sequence GATCAGCAGAAGCAACTTGAACAGGTCATTGCCAAAGACTT
Motif Score 2.951386905
Cell/Tissue List HepG2; brain; A549; hESC-HEK293T; Huh7
Seq Type List m6A-seq; m6A-REF-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000302053.7; ENST00000651975.1; ENST00000403106.8; ENST00000622532.1
External Link RMBase: m6A_site_655013
mod ID: M6ASITE068547 Click to Show/Hide the Full List
mod site chr4:154586841-154586842:- [2]
Sequence TCGTGAAGTAGATCTGAAGGACTATGAAGATCAGCAGAAGC
Motif Score 4.065041667
Cell/Tissue List HepG2; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000651975.1; ENST00000302053.7; ENST00000622532.1; ENST00000403106.8
External Link RMBase: m6A_site_655014
mod ID: M6ASITE068548 Click to Show/Hide the Full List
mod site chr4:154586913-154586914:- [4]
Sequence TCTCCCCTCTCTCTAGGTGGACATTGATATTAAGATCCGAT
Motif Score 3.643047619
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000651975.1; ENST00000403106.8; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_655015
mod ID: M6ASITE068549 Click to Show/Hide the Full List
mod site chr4:154589440-154589441:- [6]
Sequence GCCCTTCTGCTCTGATGAAGACTGGGTAAGCAGTCAGCGGG
Motif Score 3.319380952
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000651975.1; ENST00000302053.7; ENST00000622532.1
External Link RMBase: m6A_site_655016
mod ID: M6ASITE068550 Click to Show/Hide the Full List
mod site chr4:154589464-154589465:- [6]
Sequence ATCTGCCTGCAAAGATTCAGACTGGCCCTTCTGCTCTGATG
Motif Score 3.319380952
Cell/Tissue List A549; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000651975.1; ENST00000302053.7; ENST00000403106.8; ENST00000622532.1
External Link RMBase: m6A_site_655017
mod ID: M6ASITE068551 Click to Show/Hide the Full List
mod site chr4:154589490-154589491:- [6]
Sequence GGCCCAAGGGTTGTGGAAAGACATCAATCTGCCTGCAAAGA
Motif Score 2.897386905
Cell/Tissue List A549; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000403106.8; ENST00000302053.7; ENST00000622532.1; ENST00000651975.1
External Link RMBase: m6A_site_655018
mod ID: M6ASITE068552 Click to Show/Hide the Full List
mod site chr4:154590756-154590757:- [4]
Sequence CAGATTTAAATAGGATGGGAACTAGGAGTGGCAGCAATCCT
Motif Score 3.373380952
Cell/Tissue List A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000302053.7
External Link RMBase: m6A_site_655019