m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00437)

Target Name	Ubiquitin-conjugating enzyme E2 C (UBE2C)
Synonyms	(E3-independent) E2 ubiquitin-conjugating enzyme C; E2 ubiquitin-conjugating enzyme C; UbcH10; Ubiquitin carrier protein C; Ubiquitin-protein ligase C; UBCH10 Click to Show/Hide
Gene Name	UBE2C
Chromosomal Location	20q13.12
Family	ubiquitin-conjugating enzyme family
Function	Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys-11'- and 'Lys-48'-linked polyubiquitination. Acts as an essential factor of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis. Acts by initiating 'Lys-11'-linked polyubiquitin chains on APC/C substrates, leading to the degradation of APC/C substrates by the proteasome and promoting mitotic exit. Click to Show/Hide
Gene ID	11065
Uniprot ID	UBE2C_HUMAN
HGNC ID	HGNC:15937
KEGG ID	hsa:11065

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

UBE2C can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	HaCAT cell line	Homo sapiens
Treatment: siALKBH5 HaCAT cells Control: siControl HaCAT cells		GSE211076
Regulation		logFC: 9.83E-01 p-value: 3.48E-52
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Deregulated Ubiquitin-conjugating enzyme E2 C (UBE2C)-autophagy repression axis drives NSCLC progression which renders varieties of potential molecular targets in cancer therapy of NSCLC. UBE2C is repressed post-transcriptionally via tumor suppressor miR-381 and epitranscriptionally stabilized with maintenance of lower m6A level within its mature RNAs due to the upregulation of m6A demethylase ALKBH5 in NSCLC.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Cell invasion
	Ubiquitination degradation
	Cell autophagy
In-vitro Model	PLA-801D	Lung giant cell carcinoma	Homo sapiens	CVCL_7110
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBEC (Human lung cancer cell)
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Deregulated Ubiquitin-conjugating enzyme E2 C (UBE2C)-autophagy repression axis drives NSCLC progression which renders varieties of potential molecular targets in cancer therapy of NSCLC. UBE2C is repressed post-transcriptionally via tumor suppressor miR-381 and epitranscriptionally stabilized with maintenance of lower m6A level within its mature RNAs due to the upregulation of m6A demethylase ALKBH5 in NSCLC.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Cell invasion
	Ubiquitination degradation
	Cell autophagy
In-vitro Model	PLA-801D	Lung giant cell carcinoma	Homo sapiens	CVCL_7110
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-6	Lung adenocarcinoma	Homo sapiens	CVCL_0236
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H520	Lung squamous cell carcinoma	Homo sapiens	CVCL_1566
	HBEC (Human lung cancer cell)
	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00437)

Ubiquitin-conjugating enzyme E2 C (UBE2C)

5-methylcytidine (m5C)

In total 4 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002717		Click to Show/Hide the Full List
mod site	chr20:45812632-45812633:+		[2]
Sequence	TTCAAACGCGGGCGGGCGGGCCCGCAGTCCTGCAGTTGCAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000617055.4; ENST00000405520.5
External Link	RMBase: m5C_site_29130
mod ID: M5CSITE002718		Click to Show/Hide the Full List
mod site	chr20:45812633-45812634:+		[2]
Sequence	TCAAACGCGGGCGGGCGGGCCCGCAGTCCTGCAGTTGCAGT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000617055.4; ENST00000405520.5
External Link	RMBase: m5C_site_29131
mod ID: M5CSITE002719		Click to Show/Hide the Full List
mod site	chr20:45812634-45812635:+		[2]
Sequence	CAAACGCGGGCGGGCGGGCCCGCAGTCCTGCAGTTGCAGTC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000335046.7; ENST00000405520.5; ENST00000617055.4
External Link	RMBase: m5C_site_29132
mod ID: M5CSITE002720		Click to Show/Hide the Full List
mod site	chr20:45816763-45816764:+		[2]
Sequence	CAGGTCACCAGCCAGGAGCCCTGACCCAGGCTGCCCAGCCT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000405520.5; ENST00000243893.10; ENST00000352551.9; ENST00000496085.1; ENST00000372568.4; ENST00000356455.9; ENST00000335046.7; ENST00000617055.4
External Link	RMBase: m5C_site_29133

N6-methyladenosine (m6A)

In total 23 m6A sequence/site(s) in this target gene
mod ID: M6ASITE053262		Click to Show/Hide the Full List
mod site	chr20:45812708-45812709:+		[3]
Sequence	CGCCCGGATGGCTTCCCAAAACCGCGACCCAGCCGCCACTA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; A549; H1B; HEK293T; fibroblasts; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000352551.9; ENST00000243893.10; ENST00000617055.4; ENST00000356455.9; ENST00000335046.7; ENST00000405520.5
External Link	RMBase: m6A_site_533800
mod ID: M6ASITE053263		Click to Show/Hide the Full List
mod site	chr20:45813027-45813028:+		[3]
Sequence	TGAGATTCGAGAGATGGGGGACAGGCCAGGAGCTCAGACCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TREX; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405520.5; ENST00000335046.7; ENST00000617055.4; ENST00000356455.9; ENST00000372568.4; ENST00000243893.10; ENST00000352551.9
External Link	RMBase: m6A_site_533801
mod ID: M6ASITE053264		Click to Show/Hide the Full List
mod site	chr20:45813044-45813045:+		[3]
Sequence	GGGACAGGCCAGGAGCTCAGACCGCTCTTTGAGACTCTCCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TREX; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405520.5; ENST00000372568.4; ENST00000243893.10; ENST00000352551.9; ENST00000356455.9; ENST00000335046.7; ENST00000617055.4
External Link	RMBase: m6A_site_533802
mod ID: M6ASITE053265		Click to Show/Hide the Full List
mod site	chr20:45813057-45813058:+		[3]
Sequence	AGCTCAGACCGCTCTTTGAGACTCTCCCGAAGGAGAATGGG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; A549; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372568.4; ENST00000352551.9; ENST00000617055.4; ENST00000405520.5; ENST00000356455.9; ENST00000335046.7; ENST00000243893.10
External Link	RMBase: m6A_site_533803
mod ID: M6ASITE053266		Click to Show/Hide the Full List
mod site	chr20:45813097-45813098:+		[3]
Sequence	GAGGGTAGGGGCGCTGCCAGACTCCTTCCCTGGTGGGCCTA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; A549; MM6; Jurkat; peripheral-blood; GSC-11; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372568.4; ENST00000356455.9; ENST00000352551.9; ENST00000617055.4; ENST00000243893.10; ENST00000405520.5; ENST00000335046.7
External Link	RMBase: m6A_site_533804
mod ID: M6ASITE053267		Click to Show/Hide the Full List
mod site	chr20:45813135-45813136:+		[3]
Sequence	CTAGATGAAGACGCTCAAGGACCCTCGTGACTTGGCCGAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; MT4; MM6; Jurkat; peripheral-blood; GSC-11; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000243893.10; ENST00000372568.4; ENST00000335046.7; ENST00000405520.5; ENST00000352551.9; ENST00000356455.9; ENST00000617055.4
External Link	RMBase: m6A_site_533805
mod ID: M6ASITE053268		Click to Show/Hide the Full List
mod site	chr20:45813155-45813156:+		[3]
Sequence	ACCCTCGTGACTTGGCCGAGACAGGGGAAGGGAGAAGTTGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; MT4; MM6; Jurkat; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000617055.4; ENST00000335046.7; ENST00000372568.4; ENST00000352551.9; ENST00000356455.9; ENST00000405520.5; ENST00000243893.10
External Link	RMBase: m6A_site_533806
mod ID: M6ASITE053269		Click to Show/Hide the Full List
mod site	chr20:45813216-45813217:+		[4]
Sequence	TAAAGCCTGGGGAATTAAGAACATGCCAGAATCATCCCGAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; MT4; Jurkat; peripheral-blood; GSC-11
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000352551.9; ENST00000617055.4; ENST00000356455.9; ENST00000405520.5; ENST00000243893.10; ENST00000335046.7; ENST00000372568.4
External Link	RMBase: m6A_site_533807
mod ID: M6ASITE053270		Click to Show/Hide the Full List
mod site	chr20:45813263-45813264:+		[5]
Sequence	TGGAATTAGGGAGGGTGAGGACTCGCTAGGATCGTCCTGTG
Motif Score	4.065041667
Cell/Tissue List	MT4; peripheral-blood
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000243893.10; ENST00000356455.9; ENST00000405520.5; ENST00000352551.9; ENST00000372568.4; ENST00000335046.7; ENST00000617055.4
External Link	RMBase: m6A_site_533808
mod ID: M6ASITE053271		Click to Show/Hide the Full List
mod site	chr20:45814423-45814424:+		[6]
Sequence	TTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; Huh7; peripheral-blood
Seq Type List	MAZTER-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000405520.5; ENST00000496085.1; ENST00000243893.10; ENST00000335046.7; ENST00000352551.9; ENST00000617055.4; ENST00000372568.4; ENST00000356455.9
External Link	RMBase: m6A_site_533809
mod ID: M6ASITE053272		Click to Show/Hide the Full List
mod site	chr20:45814446-45814447:+		[7]
Sequence	ACCTTTTCAAATGGGTAGGGACCATCCATGGAGCAGCTGGA
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000496085.1; ENST00000617055.4; ENST00000335046.7; ENST00000352551.9; ENST00000243893.10; ENST00000405520.5; ENST00000372568.4; ENST00000356455.9
External Link	RMBase: m6A_site_533810
mod ID: M6ASITE053273		Click to Show/Hide the Full List
mod site	chr20:45814467-45814468:+		[7]
Sequence	CCATCCATGGAGCAGCTGGAACAGTAAGTGTAGGGCTGGGA
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000372568.4; ENST00000352551.9; ENST00000405520.5; ENST00000356455.9; ENST00000335046.7; ENST00000243893.10; ENST00000496085.1; ENST00000617055.4
External Link	RMBase: m6A_site_533811
mod ID: M6ASITE053274		Click to Show/Hide the Full List
mod site	chr20:45815407-45815408:+		[7]
Sequence	AGGCAGTGGGGAGCATCAGAACCAGCTCAACAGTTTGTCTA
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000496085.1; ENST00000372568.4; ENST00000356455.9; ENST00000617055.4; ENST00000335046.7; ENST00000243893.10; ENST00000352551.9; ENST00000405520.5
External Link	RMBase: m6A_site_533812
mod ID: M6ASITE053275		Click to Show/Hide the Full List
mod site	chr20:45815489-45815490:+		[5]
Sequence	TGTGTGGGGCTTGGGTTGGGACATGAGGCTGCTGCTGGAGC
Motif Score	3.643047619
Cell/Tissue List	MT4; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000496085.1; ENST00000405520.5; ENST00000335046.7; ENST00000352551.9; ENST00000372568.4; ENST00000617055.4; ENST00000356455.9; ENST00000243893.10
External Link	RMBase: m6A_site_533813
mod ID: M6ASITE053276		Click to Show/Hide the Full List
mod site	chr20:45815550-45815551:+		[5]
Sequence	CAAATGCCAGGTATATGAAGACCTGAGGTATAAGCTCTCGC
Motif Score	2.876744048
Cell/Tissue List	MT4; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000352551.9; ENST00000496085.1; ENST00000335046.7; ENST00000405520.5; ENST00000243893.10; ENST00000617055.4; ENST00000372568.4; ENST00000356455.9
External Link	RMBase: m6A_site_533814
mod ID: M6ASITE053277		Click to Show/Hide the Full List
mod site	chr20:45815595-45815596:+		[6]
Sequence	GTTCCCCAGTGGCTACCCTTACAATGCGCCCACAGTGAAGT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000352551.9; ENST00000405520.5; ENST00000356455.9; ENST00000617055.4; ENST00000496085.1; ENST00000335046.7; ENST00000243893.10; ENST00000372568.4
External Link	RMBase: m6A_site_533815
mod ID: M6ASITE053278		Click to Show/Hide the Full List
mod site	chr20:45815646-45815647:+		[6]
Sequence	CTGCTATCACCCCAACGTGGACACCCAGGGTAACATATGCC
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; MT4; Huh7
Seq Type List	MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000405520.5; ENST00000356455.9; ENST00000372568.4; ENST00000243893.10; ENST00000352551.9; ENST00000496085.1; ENST00000335046.7; ENST00000617055.4
External Link	RMBase: m6A_site_533816
mod ID: M6ASITE053279		Click to Show/Hide the Full List
mod site	chr20:45815670-45815671:+		[6]
Sequence	CCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; MT4; Huh7
Seq Type List	MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000496085.1; ENST00000243893.10; ENST00000372568.4; ENST00000405520.5; ENST00000617055.4; ENST00000352551.9; ENST00000356455.9; ENST00000335046.7
External Link	RMBase: m6A_site_533817
mod ID: M6ASITE053280		Click to Show/Hide the Full List
mod site	chr20:45815711-45815712:+		[7]
Sequence	CTGCCCTGTATGATGTCAGGACCATTCTGCTCTCCATCCAG
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000372568.4; ENST00000335046.7; ENST00000356455.9; ENST00000496085.1; ENST00000352551.9; ENST00000617055.4; ENST00000243893.10; ENST00000405520.5
External Link	RMBase: m6A_site_533818
mod ID: M6ASITE053281		Click to Show/Hide the Full List
mod site	chr20:45815859-45815860:+		[6]
Sequence	CTCTCCACCCACAGAACCCAACATTGATAGTCCCTTGAACA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000356455.9; ENST00000372568.4; ENST00000243893.10; ENST00000352551.9; ENST00000617055.4; ENST00000335046.7; ENST00000496085.1; ENST00000405520.5
External Link	RMBase: m6A_site_533819
mod ID: M6ASITE053282		Click to Show/Hide the Full List
mod site	chr20:45815877-45815878:+		[7]
Sequence	CAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCT
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000405520.5; ENST00000352551.9; ENST00000356455.9; ENST00000617055.4; ENST00000243893.10; ENST00000335046.7; ENST00000496085.1; ENST00000372568.4
External Link	RMBase: m6A_site_533820
mod ID: M6ASITE053283		Click to Show/Hide the Full List
mod site	chr20:45815904-45815905:+		[7]
Sequence	TGCTGCCGAGCTCTGGAAAAACCCCACAGGTGAGTCCTCAG
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000496085.1; ENST00000405520.5; ENST00000335046.7; ENST00000617055.4; ENST00000352551.9; ENST00000356455.9; ENST00000243893.10; ENST00000372568.4
External Link	RMBase: m6A_site_533821
mod ID: M6ASITE053284		Click to Show/Hide the Full List
mod site	chr20:45816953-45816954:+		[3]
Sequence	GCATTTTTGTCCTTTTTTAGACAAGTTGTTGCGTTGTAATT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000243893.10; ENST00000335046.7; ENST00000352551.9; ENST00000372568.4
External Link	RMBase: m6A_site_533822

Ref 1	Deregulation of UBE2C-mediated autophagy repression aggravates NSCLC progression. Oncogenesis. 2018 Jun 13;7(6):49. doi: 10.1038/s41389-018-0054-6.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun. 2019 May 6;10(1):2065. doi: 10.1038/s41467-019-09865-9.
Ref 5	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map