m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00431)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TIMP3
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5 | ||
| Cell Line | HaCAT cell line | Homo sapiens |
|
Treatment: siALKBH5 HaCAT cells
Control: siControl HaCAT cells
|
GSE211076 | |
| Regulation |
![]() ![]() |
logFC: -5.86E-01 p-value: 2.60E-20 |
| More Results | Click to View More RNA-seq Results | |
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | ALKBH5 repress Metalloproteinase inhibitor 3 (TIMP3) transcript stability, thereby inhibiting TIMP3 translational production.the present research confirmed the ALKBH5/TIMP3 pathway in the non-small cell lung cancer(NSCLC) oncogenesis progress, providing a novel insight for the epitranscriptome and potential therapeutic target for NSCLC. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Cell Process | RNA stability | |||
| Cell apoptosis | ||||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 | |
| NCI-H460 | Lung large cell carcinoma | Homo sapiens | CVCL_0459 | |
| NHBE (Normal bronchial epithelial cells) | ||||
| SK-MES-1 | Lung squamous cell carcinoma | Homo sapiens | CVCL_0630 | |
| In-vivo Model | 2 × 106 A549 cells stably transfected with shRNA-ALKBH5 were injected into the flank of male athymic BALB/c nude mice (4-5 weeks old, 10 mice). | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | The expression of CDKN1A (p21) or Metalloproteinase inhibitor 3 (TIMP3) was increased by ALKBH5 knockdown. In conclusions, the ALKBH5-IGF2BPs axis promotes cell proliferation and tumorigenicity, which in turn causes the unfavorable prognosis of NSCLC. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Arrest cell cycle at G1 phase | |||
| In-vitro Model | NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 |
| NCI-H460 | Lung large cell carcinoma | Homo sapiens | CVCL_0459 | |
| NCI-H2087 | Lung adenocarcinoma | Homo sapiens | CVCL_1524 | |
| A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 | |
| ABC-1 | Lung adenocarcinoma | Homo sapiens | CVCL_1066 | |
| NCI-H358 | Minimally invasive lung adenocarcinoma | Homo sapiens | CVCL_1559 | |
| BEAS-2B | Normal | Homo sapiens | CVCL_0168 | |
| HEK293 | Normal | Homo sapiens | CVCL_0045 | |
| PC-3 [Human lung carcinoma] | Lung adenocarcinoma | Homo sapiens | CVCL_S982 | |
| PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 | |
| RERF-LC-MS | Lung adenocarcinoma | Homo sapiens | CVCL_1655 | |
| HLC-1 | Lung adenocarcinoma | Homo sapiens | CVCL_5529 | |
| LC-2/ad | Lung adenocarcinoma | Homo sapiens | CVCL_1373 | |
Lung cancer [ICD-11: 2C25]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | ALKBH5 repress Metalloproteinase inhibitor 3 (TIMP3) transcript stability, thereby inhibiting TIMP3 translational production.the present research confirmed the ALKBH5/TIMP3 pathway in the non-small cell lung cancer(NSCLC) oncogenesis progress, providing a novel insight for the epitranscriptome and potential therapeutic target for NSCLC. | |||
| Responsed Disease | Non-small-cell lung carcinoma [ICD-11: 2C25.Y] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Down regulation | |||
| Cell Process | RNA stability | |||
| Cell apoptosis | ||||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 | |
| NCI-H460 | Lung large cell carcinoma | Homo sapiens | CVCL_0459 | |
| NHBE (Normal bronchial epithelial cells) | ||||
| SK-MES-1 | Lung squamous cell carcinoma | Homo sapiens | CVCL_0630 | |
| In-vivo Model | 2 × 106 A549 cells stably transfected with shRNA-ALKBH5 were injected into the flank of male athymic BALB/c nude mice (4-5 weeks old, 10 mice). | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | The expression of CDKN1A (p21) or Metalloproteinase inhibitor 3 (TIMP3) was increased by ALKBH5 knockdown. In conclusions, the ALKBH5-IGF2BPs axis promotes cell proliferation and tumorigenicity, which in turn causes the unfavorable prognosis of NSCLC. | |||
| Responsed Disease | Non-small-cell lung carcinoma [ICD-11: 2C25.Y] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Arrest cell cycle at G1 phase | |||
| In-vitro Model | NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 |
| NCI-H460 | Lung large cell carcinoma | Homo sapiens | CVCL_0459 | |
| NCI-H2087 | Lung adenocarcinoma | Homo sapiens | CVCL_1524 | |
| A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 | |
| ABC-1 | Lung adenocarcinoma | Homo sapiens | CVCL_1066 | |
| NCI-H358 | Minimally invasive lung adenocarcinoma | Homo sapiens | CVCL_1559 | |
| BEAS-2B | Normal | Homo sapiens | CVCL_0168 | |
| HEK293 | Normal | Homo sapiens | CVCL_0045 | |
| PC-3 [Human lung carcinoma] | Lung adenocarcinoma | Homo sapiens | CVCL_S982 | |
| PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 | |
| RERF-LC-MS | Lung adenocarcinoma | Homo sapiens | CVCL_1655 | |
| HLC-1 | Lung adenocarcinoma | Homo sapiens | CVCL_5529 | |
| LC-2/ad | Lung adenocarcinoma | Homo sapiens | CVCL_1373 | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00431)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE002904 | Click to Show/Hide the Full List | ||
| mod site | chr22:32801903-32801904:+ | [4] | |
| Sequence | GGTTGCCCCGCACGGCCCGGCGGGCGAGCGAGCTCGGGCTG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m5C_site_30695 | ||
| mod ID: M5CSITE002905 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861745-32861746:+ | [5] | |
| Sequence | CGCAAAGCGATGTCAGAGGGCGGTTTTGAGCTTTCTATAAG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m5C_site_30696 | ||
N6-methyladenosine (m6A)
| In total 65 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE057825 | Click to Show/Hide the Full List | ||
| mod site | chr22:32802053-32802054:+ | [6] | |
| Sequence | GGGCAGCTGGAGCCTGGGGGACTGGGGCGCCGAGGCGTGCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; GSC-11; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563368 | ||
| mod ID: M6ASITE057826 | Click to Show/Hide the Full List | ||
| mod site | chr22:32802116-32802117:+ | [7] | |
| Sequence | GGACGCCTTCTGCAACTCCGACATCGGTAAGCGCTCCTGGT | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563369 | ||
| mod ID: M6ASITE057827 | Click to Show/Hide the Full List | ||
| mod site | chr22:32849514-32849515:+ | [7] | |
| Sequence | GCCCTTCGGCACGCTGGTCTACACCATCAAGCAGATGAAGG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563370 | ||
| mod ID: M6ASITE057828 | Click to Show/Hide the Full List | ||
| mod site | chr22:32857285-32857286:+ | [7] | |
| Sequence | CAAGATGCCCCATGTGCAGTACATCCATACGGAAGCTTCCG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563371 | ||
| mod ID: M6ASITE057829 | Click to Show/Hide the Full List | ||
| mod site | chr22:32857336-32857337:+ | [7] | |
| Sequence | TGGCCTTAAGCTGGAGGTCAACAAGTACCAGTACCTGCTGA | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563372 | ||
| mod ID: M6ASITE057830 | Click to Show/Hide the Full List | ||
| mod site | chr22:32858040-32858041:+ | [7] | |
| Sequence | CGTCTATGATGGCAAGATGTACACGGGGCTGTGCAACTTCG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563373 | ||
| mod ID: M6ASITE057831 | Click to Show/Hide the Full List | ||
| mod site | chr22:32858073-32858074:+ | [8] | |
| Sequence | CAACTTCGTGGAGAGGTGGGACCAGCTCACCCTCTCCCAGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563374 | ||
| mod ID: M6ASITE057832 | Click to Show/Hide the Full List | ||
| mod site | chr22:32858106-32858107:+ | [8] | |
| Sequence | CTCCCAGCGCAAGGGGCTGAACTATCGGTATCACCTGGGTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563375 | ||
| mod ID: M6ASITE057833 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859236-32859237:+ | [9] | |
| Sequence | CCAAGAACGAGTGTCTCTGGACCGACATGCTCTCCAATTTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563376 | ||
| mod ID: M6ASITE057834 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859240-32859241:+ | [7] | |
| Sequence | GAACGAGTGTCTCTGGACCGACATGCTCTCCAATTTCGGTT | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563377 | ||
| mod ID: M6ASITE057835 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859280-32859281:+ | [6] | |
| Sequence | TACCCTGGCTACCAGTCCAAACACTACGCCTGCATCCGGCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563378 | ||
| mod ID: M6ASITE057836 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859369-32859370:+ | [6] | |
| Sequence | AAGCATCATCAATGCCACAGACCCCTGAGCGCCAGACCCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563379 | ||
| mod ID: M6ASITE057837 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859384-32859385:+ | [6] | |
| Sequence | CACAGACCCCTGAGCGCCAGACCCTGCCCCACCTCACTTCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563380 | ||
| mod ID: M6ASITE057838 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859431-32859432:+ | [6] | |
| Sequence | TCCCGCTGAGCTTCCCTTGGACACTAACTCTTCCCAGATGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; brain; kidney; liver; hESC-HEK293T; U2OS; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563381 | ||
| mod ID: M6ASITE057839 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859437-32859438:+ | [10] | |
| Sequence | TGAGCTTCCCTTGGACACTAACTCTTCCCAGATGATGACAA | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563382 | ||
| mod ID: M6ASITE057840 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859454-32859455:+ | [10] | |
| Sequence | CTAACTCTTCCCAGATGATGACAATGAAATTAGTGCCTGTT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563383 | ||
| mod ID: M6ASITE057841 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859498-32859499:+ | [6] | |
| Sequence | TTGCAAATTTAGCACTTGGAACATTTAAAGAAAGGTCTATG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; kidney; U2OS; H1B; hNPCs; fibroblasts; Huh7; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563384 | ||
| mod ID: M6ASITE057842 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859542-32859543:+ | [6] | |
| Sequence | TCATATGGGGTTTATTGGGAACTATCCTCCTGGCCCCACCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; Huh7; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563385 | ||
| mod ID: M6ASITE057843 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859584-32859585:+ | [7] | |
| Sequence | GCCCCTTCTTTTTGGTTTTGACATCATTCATTTCCACCTGG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563386 | ||
| mod ID: M6ASITE057844 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859638-32859639:+ | [11] | |
| Sequence | CATGCCAGAAAGAATGAGGAACCTGTATTCCTCTTCTTCGT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563387 | ||
| mod ID: M6ASITE057845 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859688-32859689:+ | [7] | |
| Sequence | ATCTCTATTTTTTTAGGAAAACAAAAATGAAAAACTACTCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T; Huh7 | ||
| Seq Type List | MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563388 | ||
| mod ID: M6ASITE057846 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859701-32859702:+ | [6] | |
| Sequence | TAGGAAAACAAAAATGAAAAACTACTCCATTTGAGGATTGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563389 | ||
| mod ID: M6ASITE057847 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859704-32859705:+ | [10] | |
| Sequence | GAAAACAAAAATGAAAAACTACTCCATTTGAGGATTGTAAT | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563390 | ||
| mod ID: M6ASITE057848 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859766-32859767:+ | [6] | |
| Sequence | CCCACCTCACCATCTCCCAGACCCTCTTCCCTTTGCCCTTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; Huh7; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6; rmsk_5277560 | ||
| External Link | RMBase: m6A_site_563391 | ||
| mod ID: M6ASITE057849 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859805-32859806:+ | [6] | |
| Sequence | TCTCCTCCAATACATAAAGGACACAGACAAGGAACTTGCTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; fibroblasts; Huh7; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563392 | ||
| mod ID: M6ASITE057850 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859811-32859812:+ | [6] | |
| Sequence | CCAATACATAAAGGACACAGACAAGGAACTTGCTGAAAGGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; fibroblasts; Huh7; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563393 | ||
| mod ID: M6ASITE057851 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859818-32859819:+ | [6] | |
| Sequence | ATAAAGGACACAGACAAGGAACTTGCTGAAAGGCCAACCAT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; fibroblasts; Huh7; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563394 | ||
| mod ID: M6ASITE057852 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859871-32859872:+ | [6] | |
| Sequence | CAAAGGCAGCAAGCAGATAGACTCAAGGTGTGTGAAAGATG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; fibroblasts; Huh7; GSC-11; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563395 | ||
| mod ID: M6ASITE057853 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859929-32859930:+ | [6] | |
| Sequence | CCACTGCATGTCCCAACCAGACTGTGTCTGTCTGTGTCTGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; Huh7; GSC-11; HEK293A-TOA; endometrial; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563396 | ||
| mod ID: M6ASITE057854 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859978-32859979:+ | [8] | |
| Sequence | GTGAGGGAGGGAAGGAAGGAACTACAAGAGAGTCGGAGATG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; HeLa; HEK293T; Huh7; GSC-11; HEK293A-TOA; endometrial; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563397 | ||
| mod ID: M6ASITE057855 | Click to Show/Hide the Full List | ||
| mod site | chr22:32859981-32859982:+ | [12] | |
| Sequence | AGGGAGGGAAGGAAGGAACTACAAGAGAGTCGGAGATGATG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | kidney; liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563398 | ||
| mod ID: M6ASITE057856 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860008-32860009:+ | [10] | |
| Sequence | AGTCGGAGATGATGCAGCACACACACAATTCCCCAGCCCAG | ||
| Motif Score | 2.084928571 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563399 | ||
| mod ID: M6ASITE057857 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860110-32860111:+ | [11] | |
| Sequence | AGCTTTCTTAGTTGGTGAAGACTTAAACATCTGCCTGAGGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Huh7; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563400 | ||
| mod ID: M6ASITE057858 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860116-32860117:+ | [9] | |
| Sequence | CTTAGTTGGTGAAGACTTAAACATCTGCCTGAGGTCAGGAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563401 | ||
| mod ID: M6ASITE057859 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860155-32860156:+ | [12] | |
| Sequence | AGGCAATTTGCCTGCCTTGTACAAAAGCTCAGGTGAAAGAC | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | brain; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563402 | ||
| mod ID: M6ASITE057860 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860213-32860214:+ | [11] | |
| Sequence | CTCTCCCTGCCTCCCACCAGACTTCCTCCTGGAAAACGCTT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563403 | ||
| mod ID: M6ASITE057861 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860228-32860229:+ | [10] | |
| Sequence | ACCAGACTTCCTCCTGGAAAACGCTTTGGTAGATTTGGCCA | ||
| Motif Score | 2.179660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563404 | ||
| mod ID: M6ASITE057862 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860279-32860280:+ | [7] | |
| Sequence | TTTATGTAAATTGGATAAATACACACACCATACACTATCCA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563405 | ||
| mod ID: M6ASITE057863 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860380-32860381:+ | [7] | |
| Sequence | CTAGGGGGATATGTTTGTATACACATTTGCATATACCCACA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563406 | ||
| mod ID: M6ASITE057864 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860406-32860407:+ | [6] | |
| Sequence | TTGCATATACCCACATGGGGACATAAGCTAATTTTTTTACA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563407 | ||
| mod ID: M6ASITE057865 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860429-32860430:+ | [6] | |
| Sequence | TAAGCTAATTTTTTTACAGGACACAGAATTCTGTTCAATGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563408 | ||
| mod ID: M6ASITE057866 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860516-32860517:+ | [10] | |
| Sequence | CTTGTTTGAAGAAAATCATGACATTCCAAGTTGACATTTTT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563409 | ||
| mod ID: M6ASITE057867 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860760-32860761:+ | [6] | |
| Sequence | TGCCTGCCTTGGCTGGAGGGACACCTCTCCTGGGTGTGGAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563410 | ||
| mod ID: M6ASITE057868 | Click to Show/Hide the Full List | ||
| mod site | chr22:32860781-32860782:+ | [6] | |
| Sequence | CACCTCTCCTGGGTGTGGAGACAGCTTGGTTCCCTTTCCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563411 | ||
| mod ID: M6ASITE057869 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861028-32861029:+ | [12] | |
| Sequence | TAGGTGATAATGTATATTTTACAGAGTGGGGGTTGGCAGGA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563412 | ||
| mod ID: M6ASITE057870 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861166-32861167:+ | [9] | |
| Sequence | AAACAGAGCTGCCAATTGAAACAGAAGAAGAAAAAAAAAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563413 | ||
| mod ID: M6ASITE057871 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861196-32861197:+ | [9] | |
| Sequence | AAAAAAAAAAAAAGCAGCAGACAACACACTGTAGAGTCTTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563414 | ||
| mod ID: M6ASITE057872 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861218-32861219:+ | [10] | |
| Sequence | AACACACTGTAGAGTCTTGCACACACACAAGTGCCCAGGCA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563415 | ||
| mod ID: M6ASITE057873 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861253-32861254:+ | [9] | |
| Sequence | CAGGCAAGGTGCTTGGCAGAACCGCAGAGTGGGAAGAGAGT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563416 | ||
| mod ID: M6ASITE057874 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861437-32861438:+ | [9] | |
| Sequence | TTTTGAAGGGATGAGCCCAGACTTGATGTTTTGGGATTGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563417 | ||
| mod ID: M6ASITE057875 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861529-32861530:+ | [9] | |
| Sequence | AAGTTCCCTCCCACAAGTGGACATCAGTGTCTTCTCTGTGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563418 | ||
| mod ID: M6ASITE057876 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861605-32861606:+ | [9] | |
| Sequence | CCTCTCTCACACAAGGAGGAACTTGGGTGAAGGCTGAGTGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563419 | ||
| mod ID: M6ASITE057877 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861668-32861669:+ | [9] | |
| Sequence | GGAGTCGATAAATTAGCAGAACCACATCCCCATCTGTTAGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563420 | ||
| mod ID: M6ASITE057878 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861671-32861672:+ | [12] | |
| Sequence | GTCGATAAATTAGCAGAACCACATCCCCATCTGTTAGGCCT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | liver; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563421 | ||
| mod ID: M6ASITE057879 | Click to Show/Hide the Full List | ||
| mod site | chr22:32861830-32861831:+ | [7] | |
| Sequence | AAATCATTTATGTAGCTGAGACACTTCTGTATTTCAATCAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563422 | ||
| mod ID: M6ASITE057880 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862511-32862512:+ | [9] | |
| Sequence | ACTACCCTTCCATGCCCCAGACCTCTGTCTTGCATGTGACA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563423 | ||
| mod ID: M6ASITE057881 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862545-32862546:+ | [9] | |
| Sequence | TGTGACAATTGACAATCTGGACTACCCCAAGATGGCACCCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563424 | ||
| mod ID: M6ASITE057882 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862623-32862624:+ | [9] | |
| Sequence | CTAGAGTATTTTTATGAGAGACAAACATTATAAAAATCTGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563425 | ||
| mod ID: M6ASITE057883 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862657-32862658:+ | [9] | |
| Sequence | AATCTGATGGCAAAAGCAAAACAAAATGGAAAGTAGGGGAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563426 | ||
| mod ID: M6ASITE057884 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862690-32862691:+ | [7] | |
| Sequence | TAGGGGAGGTGGATGTGACAACAACTTCCAAATTGGCTCTT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563427 | ||
| mod ID: M6ASITE057885 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862733-32862734:+ | [8] | |
| Sequence | GAGGCGAGAGGAAGGGGAGAACTTGGAGAATAGTTTTTGCT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563428 | ||
| mod ID: M6ASITE057886 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862822-32862823:+ | [8] | |
| Sequence | AGCCAGTCTGCTGTCCTGAAACCCAGAAGTGATGGAGAGAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563429 | ||
| mod ID: M6ASITE057887 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862843-32862844:+ | [8] | |
| Sequence | CCCAGAAGTGATGGAGAGAAACCAACAAGAGATCTCGAACC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563430 | ||
| mod ID: M6ASITE057888 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862861-32862862:+ | [8] | |
| Sequence | AAACCAACAAGAGATCTCGAACCCTGTCTAGAAGGAATGTA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563431 | ||
| mod ID: M6ASITE057889 | Click to Show/Hide the Full List | ||
| mod site | chr22:32862985-32862986:+ | [10] | |
| Sequence | TGTAATGTTGCATAATGTTCACTTTTTATAGTGTGTCCTTT | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000266085.6 | ||
| External Link | RMBase: m6A_site_563432 | ||
References

