m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00423)
Target Name T-cell acute lymphocytic leukemia protein 1 (TAL1)
Synonyms
TAL-1; Class A basic helix-loop-helix protein 17; bHLHa17; Stem cell protein; T-cell leukemia/lymphoma protein 5; BHLHA17; SCL; TCL5
    Click to Show/Hide
Gene Name TAL1
Chromosomal Location 1p33
Function
Implicated in the genesis of hemopoietic malignancies. It may play an important role in hemopoietic differentiation. Serves as a positive regulator of erythroid differentiation (By similarity).
    Click to Show/Hide
Gene ID 6886
Uniprot ID
TAL1_HUMAN
HGNC ID
HGNC:11556
KEGG ID
hsa:6886
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TAL1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between TAL1 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 2.17E+00 GSE49339
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Knocking down one of YTHDF2's key targets, T-cell acute lymphocytic leukemia protein 1 (TAL1) mRNA, partially rescued the phenotype.the function of YTHDF2 in adult stem cell maintenance and identifies its important role in regulating HSC ex vivo expansion.
Target Regulation Down regulation
Responsed Disease Hematological disorders ICD-11: 3C0Z
 Disease Info 
Cell Process RNA stability
In-vitro Model Hematopoietic stem cells (Hematopoietic stem cells)
In-vivo Model For the rescue experiment, LSK cells were sorted from wt and Ythdf2 KO mouse BM and cultured overnight in StemSpan SFEM medium (Stem Cell Technologies) supplemented with 10 ug/mL heparin (Sigma), 0.5 × penicillin/streptomycin (Sigma), 10 ng/mL recombinant mouse (rm) stem cell factor (SCF), and 20 ng/mL Tpo 75 at 37 ℃ in a 5% CO2 5% O2 atmosphere.
Hematological disorders [ICD-11: 3C0Z]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Knocking down one of YTHDF2's key targets, T-cell acute lymphocytic leukemia protein 1 (TAL1) mRNA, partially rescued the phenotype.the function of YTHDF2 in adult stem cell maintenance and identifies its important role in regulating HSC ex vivo expansion.
Responsed Disease Hematological disorders [ICD-11: 3C0Z]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Cell Process RNA stability
In-vitro Model Hematopoietic stem cells (Hematopoietic stem cells)
In-vivo Model For the rescue experiment, LSK cells were sorted from wt and Ythdf2 KO mouse BM and cultured overnight in StemSpan SFEM medium (Stem Cell Technologies) supplemented with 10 ug/mL heparin (Sigma), 0.5 × penicillin/streptomycin (Sigma), 10 ng/mL recombinant mouse (rm) stem cell factor (SCF), and 20 ng/mL Tpo 75 at 37 ℃ in a 5% CO2 5% O2 atmosphere.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00423)
T-cell acute lymphocytic leukemia protein 1 (TAL1)
N6-methyladenosine (m6A)
In total 17 m6A sequence/site(s) in this target gene
mod ID: M6ASITE024425 Click to Show/Hide the Full List
mod site chr1:47216365-47216366:- [1]
Sequence GTGACTCTTTAGCAAAAAAAACCCATGTGGTGATGATGTGT
Motif Score 2.185083333
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000294339.3; ENST00000371884.6
External Link RMBase: m6A_site_29293
mod ID: M6ASITE024426 Click to Show/Hide the Full List
mod site chr1:47219380-47219381:- [2]
Sequence GGATCCCTGTCTTTCCTAAGACCTGGGGTTGTCAGCTCTCA
Motif Score 2.876744048
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000371884.6; ENST00000459729.1; ENST00000294339.3
External Link RMBase: m6A_site_29294
mod ID: M6ASITE024427 Click to Show/Hide the Full List
mod site chr1:47219586-47219587:- [3]
Sequence GAACTTTCCTGGATGTCTGAACTTTGGGAAGCCTTTACTGA
Motif Score 3.373380952
Cell/Tissue List H1A; Jurkat; HEK293A-TOA; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000459729.1; ENST00000371884.6; ENST00000294339.3
External Link RMBase: m6A_site_29295
mod ID: M6ASITE024428 Click to Show/Hide the Full List
mod site chr1:47219604-47219605:- [3]
Sequence AAGCAAGGCGGTGGACTTGAACTTTCCTGGATGTCTGAACT
Motif Score 3.373380952
Cell/Tissue List H1A; Jurkat; HEK293A-TOA; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371884.6; ENST00000294339.3; ENST00000459729.1
External Link RMBase: m6A_site_29296
mod ID: M6ASITE024429 Click to Show/Hide the Full List
mod site chr1:47219610-47219611:- [3]
Sequence GCTCTGAAGCAAGGCGGTGGACTTGAACTTTCCTGGATGTC
Motif Score 4.065041667
Cell/Tissue List H1A; Jurkat; HEK293A-TOA; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000459729.1; ENST00000294339.3; ENST00000371884.6
External Link RMBase: m6A_site_29297
mod ID: M6ASITE024430 Click to Show/Hide the Full List
mod site chr1:47219810-47219811:- [1]
Sequence GGATGGGGCAGCCAGCCCGGACAGCTACACGGAGGAGCCCG
Motif Score 3.643047619
Cell/Tissue List CD34; Jurkat; HEK293A-TOA; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371884.6; ENST00000294339.3; ENST00000459729.1
External Link RMBase: m6A_site_29298
mod ID: M6ASITE024431 Click to Show/Hide the Full List
mod site chr1:47219939-47219940:- [1]
Sequence GCGGGCCAAGACTGGCAAGGACCCTGTGGTGGGGGCTGGTG
Motif Score 3.622404762
Cell/Tissue List CD34; Jurkat; HEK293A-TOA; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000459729.1; ENST00000294339.3; ENST00000371884.6
External Link RMBase: m6A_site_29299
mod ID: M6ASITE024432 Click to Show/Hide the Full List
mod site chr1:47219949-47219950:- [1]
Sequence AGGGCACCCAGCGGGCCAAGACTGGCAAGGACCCTGTGGTG
Motif Score 3.319380952
Cell/Tissue List CD34; Jurkat; HEK293A-TOA; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000294339.3; ENST00000459729.1; ENST00000371884.6
External Link RMBase: m6A_site_29300
mod ID: M6ASITE024433 Click to Show/Hide the Full List
mod site chr1:47220056-47220057:- [1]
Sequence GATCCCCACACATCCCCCGGACAAGAAGCTCAGCAAGAATG
Motif Score 3.643047619
Cell/Tissue List CD34; Jurkat; HEK293A-TOA; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371884.6; ENST00000459729.1; ENST00000294339.3
External Link RMBase: m6A_site_29301
mod ID: M6ASITE024434 Click to Show/Hide the Full List
mod site chr1:47224034-47224035:- [1]
Sequence AACAATCGAGTGAAGAGGAGACCTTCCCCCTATGAGATGGA
Motif Score 2.876744048
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000294339.3; ENST00000459729.1; ENST00000371884.6
External Link RMBase: m6A_site_29302
mod ID: M6ASITE024435 Click to Show/Hide the Full List
mod site chr1:47225603-47225604:- [1]
Sequence CCCACCACCGAGCTGTGCAGACCTCCCGGGCCCGCCCCGGC
Motif Score 2.876744048
Cell/Tissue List CD34; Jurkat; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000294339.3; ENST00000464796.5; ENST00000371884.6
External Link RMBase: m6A_site_29303
mod ID: M6ASITE024436 Click to Show/Hide the Full List
mod site chr1:47225670-47225671:- [4]
Sequence TGGGGGCGGCGCCGCGAGAGACTTAAAGGGCCGCGACGCGG
Motif Score 3.319380952
Cell/Tissue List Jurkat
Seq Type List m6A-seq
Transcript ID List ENST00000294339.3; ENST00000464796.5; ENST00000371884.6
External Link RMBase: m6A_site_29304
mod ID: M6ASITE024437 Click to Show/Hide the Full List
mod site chr1:47225729-47225730:- [4]
Sequence GCGGAGCCCCCAGTCATCGAACTGGGCGCGCGCGGAGGCCC
Motif Score 3.373380952
Cell/Tissue List Jurkat
Seq Type List m6A-seq
Transcript ID List ENST00000294339.3; ENST00000371884.6; ENST00000464796.5
External Link RMBase: m6A_site_29305
mod ID: M6ASITE024438 Click to Show/Hide the Full List
mod site chr1:47228360-47228361:- [4]
Sequence TTCATTCTCCCCAAATAAAAACAAACAAAATCTCTCGGGCG
Motif Score 2.20572619
Cell/Tissue List Jurkat
Seq Type List m6A-seq
Transcript ID List ENST00000465912.1; ENST00000294339.3; ENST00000464796.5; ENST00000371884.6; ENST00000481091.1
External Link RMBase: m6A_site_29306
mod ID: M6ASITE024439 Click to Show/Hide the Full List
mod site chr1:47229287-47229288:- [2]
Sequence GAAAAAGGGGGAAAGCAAAGACCCGGGTGTGCATCCTCTTC
Motif Score 2.876744048
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000371884.6; ENST00000481091.1; ENST00000294339.3; ENST00000464796.5; ENST00000465912.1
External Link RMBase: m6A_site_29307
mod ID: M6ASITE024440 Click to Show/Hide the Full List
mod site chr1:47229340-47229341:- [2]
Sequence GGCGCGGCAGATCGCCCAGGACCACACCGCAGCGTAACTGC
Motif Score 3.622404762
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000294339.3; ENST00000465912.1; ENST00000464796.5; ENST00000481091.1; ENST00000371884.6
External Link RMBase: m6A_site_29308
mod ID: M6ASITE024441 Click to Show/Hide the Full List
mod site chr1:47229370-47229371:- [2]
Sequence CACCCCTATCTTTCCTGGAAACTCGCTTTGGGCGCGGCAGA
Motif Score 2.627720238
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000371884.6; ENST00000481091.1; ENST00000464796.5; ENST00000465912.1; ENST00000294339.3
External Link RMBase: m6A_site_29309