General Information of the m6A Target Gene (ID: M6ATAR00413)
Target Name Scavenger receptor class F member 1 (SCARF1)
Synonyms
Acetyl LDL receptor; Scavenger receptor expressed by endothelial cells 1; SREC-I; KIAA0149; SREC
    Click to Show/Hide
Gene Name SCARF1
Chromosomal Location 17p13.3
Function
Mediates the binding and degradation of acetylated low density lipoprotein (Ac-LDL). Mediates heterophilic interactions, suggesting a function as adhesion protein. Plays a role in the regulation of neurite-like outgrowth (By similarity).
    Click to Show/Hide
Gene ID 8578
Uniprot ID
SREC_HUMAN
HGNC ID
HGNC:16820
KEGG ID
hsa:8578
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SCARF1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line NOMO-1 cell line Homo sapiens
Treatment: shALKBH5 NOMO-1 cells
Control: shNS NOMO-1 cells
GSE144968
Regulation
logFC: 5.88E-01
p-value: 6.33E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary IOX1, which is an inhibitor of ALKBH5, was loaded on HSSS to form HSSS-I, which could effectively ameliorate cardiac dysfunction in acute myocardial infarction. The surface-modified bioengineered ferritin nanocage targeted the dying cells in the infarct area under the guidance of Scavenger receptor class F member 1 (SCARF1). These cells were then phagocytosed through recognition of their TfR1 receptor.
Responsed Disease Acute myocardial infarction ICD-11: BA41
Cell Process Lysosomal escape
In-vivo Model Wild-type C57 (female, 12-16 weeks old), ALKBH5 /- mice (female and male, 12-16 weeks old), and SPF-grade SD rats (female, 180-230 g) were used to establish the AMI model.Sodium pentobarbital diluted to 10 mg/mL was used to anesthetize the mice or rat at the dose of 50 mg/kg through an intraperitoneal injection. By using a small animal ventilator with endotracheal intubation, thoracotomy was performed at the left fourth intercostal region. The heart was exposed, and the left anterior descending coronary artery (LCA) was occluded through a 6-0 silk suture that was placed 2-3 mm distal to the origin of the LCA with a slipknot. The apical region turned white, and ST segment elevation and T wave inversion of ECG showed that the AMI model was successfully established. Forty-five minutes after ischemia, the slipknot was released, and the ischemic region was reperfused. PBS (0.2 ml), HSSS (23.5 mg/kg, 0.2 ml), IOX1 (10 mg/kg, 0.2 ml), and HSSS-I (33.5 mg/kg, containing 10 mg/kg IOX1, 0.2 ml) were administered through caudal vein injection for 14 days at the frequency of one time per day.
Acute myocardial infarction [ICD-11: BA41]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary IOX1, which is an inhibitor of ALKBH5, was loaded on HSSS to form HSSS-I, which could effectively ameliorate cardiac dysfunction in acute myocardial infarction. The surface-modified bioengineered ferritin nanocage targeted the dying cells in the infarct area under the guidance of Scavenger receptor class F member 1 (SCARF1). These cells were then phagocytosed through recognition of their TfR1 receptor.
Responsed Disease Acute myocardial infarction [ICD-11: BA41]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
Cell Process Lysosomal escape
In-vivo Model Wild-type C57 (female, 12-16 weeks old), ALKBH5 /- mice (female and male, 12-16 weeks old), and SPF-grade SD rats (female, 180-230 g) were used to establish the AMI model.Sodium pentobarbital diluted to 10 mg/mL was used to anesthetize the mice or rat at the dose of 50 mg/kg through an intraperitoneal injection. By using a small animal ventilator with endotracheal intubation, thoracotomy was performed at the left fourth intercostal region. The heart was exposed, and the left anterior descending coronary artery (LCA) was occluded through a 6-0 silk suture that was placed 2-3 mm distal to the origin of the LCA with a slipknot. The apical region turned white, and ST segment elevation and T wave inversion of ECG showed that the AMI model was successfully established. Forty-five minutes after ischemia, the slipknot was released, and the ischemic region was reperfused. PBS (0.2 ml), HSSS (23.5 mg/kg, 0.2 ml), IOX1 (10 mg/kg, 0.2 ml), and HSSS-I (33.5 mg/kg, containing 10 mg/kg IOX1, 0.2 ml) were administered through caudal vein injection for 14 days at the frequency of one time per day.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00413)
Scavenger receptor class F member 1 (SCARF1)
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE029328 Click to Show/Hide the Full List
mod site chr17:1633966-1633967:- [2]
Sequence GTATAGTTTGCAAATTTTCTACAGTGAACATTCTTTTTTAC
Motif Score 2.078666667
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000263071.9; rmsk_4614356; ENST00000434376.6
External Link RMBase: m6A_site_340140