m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00394)
Target Name NAD-dependent protein deacetylase sirtuin-6 (SIRT6)
Synonyms
Regulatory protein SIR2 homolog 6; SIR2-like protein 6; SIR2L6
    Click to Show/Hide
Gene Name SIRT6
Chromosomal Location 19p13.3
Family sirtuin family; Class IV subfamily
Function
NAD-dependent protein deacetylase involved in various processes including telomere maintenance and gene expression, and consequently has roles in genomic stability, cell senescence and apoptosis . Has very weak deacetylase activity and can bind NAD(+) in the absence of acetylated substrate. Has deacetylase activity towards histone H3K9Ac and H3K56Ac. Modulates acetylation of histone H3 in telomeric chromatin during the S-phase of the cell cycle. May also be required for the association of WRN with telomeres during S-phase and for normal telomere maintenance. Deacetylates histone H3K9Ac at NF-kappa-B target promoters and may down-regulate the expression of a subset of NF-kappa-B target genes. Deacetylation of nucleosomes interferes with RELA binding to target DNA. Acts as a corepressor of the transcription factor Hif1a to control the expression of multiple glycolytic genes to regulate glucose homeostasis (By similarity). Required for normal IGF1 serum levels and normal glucose homeostasis (By similarity). Regulates the production of TNF protein (By similarity). Has a role in the regulation of life span (By similarity).
    Click to Show/Hide
Gene ID 51548
Uniprot ID
SIR6_HUMAN
HGNC ID
HGNC:14934
KEGG ID
hsa:51548
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SIRT6 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Methyltransferase-like 14 (Mettl14)-induced m6A modification participated in the regulation of USP48 in hepatocellular carcinoma by maintaining USP48 mRNA stability. This work uncovers the tumor-suppressive function of the Mettl14-USP48-NAD-dependent protein deacetylase sirtuin-6 (SIRT6) axis via modulation of glycolysis, providing new insights into the critical roles of metabolic activities in HCC and identifying an attractive target for future treatment studies.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response Ubiquitin mediated proteolysis hsa04120
Glycolysis / Gluconeogenesis hsa00010
Cell Process Ubiquitination degradation
Glycolysis
In-vitro Model BEL-7404 Endocervical adenocarcinoma Homo sapiens CVCL_6568
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
SK-HEP-1 Liver and intrahepatic bile duct epithelial neoplasm Homo sapiens CVCL_0525
SK-HEP-1 Liver and intrahepatic bile duct epithelial neoplasm Homo sapiens CVCL_0525
In-vivo Model Hepatocyte-specific knockout USP48 was obtained by crossing Alb-Cre mice with USP48flox/flox mice.
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Methyltransferase-like 14 (Mettl14)-induced m6A modification participated in the regulation of USP48 in hepatocellular carcinoma by maintaining USP48 mRNA stability. This work uncovers the tumor-suppressive function of the Mettl14-USP48-NAD-dependent protein deacetylase sirtuin-6 (SIRT6) axis via modulation of glycolysis, providing new insights into the critical roles of metabolic activities in HCC and identifying an attractive target for future treatment studies.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Ubiquitin mediated proteolysis hsa04120
Glycolysis / Gluconeogenesis hsa00010
Cell Process Ubiquitination degradation
Glycolysis
In-vitro Model BEL-7404 Endocervical adenocarcinoma Homo sapiens CVCL_6568
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
SK-HEP-1 Liver and intrahepatic bile duct epithelial neoplasm Homo sapiens CVCL_0525
SK-HEP-1 Liver and intrahepatic bile duct epithelial neoplasm Homo sapiens CVCL_0525
In-vivo Model Hepatocyte-specific knockout USP48 was obtained by crossing Alb-Cre mice with USP48flox/flox mice.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00394)
NAD-dependent protein deacetylase sirtuin-6 (SIRT6)
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001653 Click to Show/Hide the Full List
mod site chr19:4174491-4174492:-
Sequence CTGAGAGCTGTGCTCCAGGCCAGGGGTTACACCTGCCCTCC
Cell/Tissue List muscle
Seq Type List Bisulfite-seq
Transcript ID List ENST00000600938.5; ENST00000305232.10; ENST00000594279.5; ENST00000601488.5; ENST00000337491.7; ENST00000599365.5
External Link RMBase: m5C_site_22070
N6-methyladenosine (m6A)
In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE038493 Click to Show/Hide the Full List
mod site chr19:4174124-4174125:- [2]
Sequence AAGTCCTCAATGCAATAAAAACAATTTCTTTCTTGCATCTC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000601488.5; ENST00000600938.5; ENST00000599365.5; ENST00000305232.10; ENST00000337491.7
External Link RMBase: m6A_site_411802
mod ID: M6ASITE038494 Click to Show/Hide the Full List
mod site chr19:4174227-4174228:- [2]
Sequence TGGGCCCTGCAGGAGGGGAGACCCACCTTGAAGTGGGGGAT
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000599365.5; ENST00000594279.5; ENST00000601488.5; ENST00000305232.10; ENST00000600938.5; ENST00000337491.7
External Link RMBase: m6A_site_411803
mod ID: M6ASITE038495 Click to Show/Hide the Full List
mod site chr19:4174309-4174310:- [2]
Sequence TCCAGCTTAAACAGGAGTGAACTCCCTCTGTCCCCAGGGCC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000594279.5; ENST00000337491.7; ENST00000601488.5; ENST00000599365.5; ENST00000305232.10; ENST00000600938.5
External Link RMBase: m6A_site_411804
mod ID: M6ASITE038496 Click to Show/Hide the Full List
mod site chr19:4174319-4174320:- [2]
Sequence CTCCCTGGTCTCCAGCTTAAACAGGAGTGAACTCCCTCTGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000601488.5; ENST00000337491.7; ENST00000600938.5; ENST00000594279.5; ENST00000305232.10; ENST00000599365.5
External Link RMBase: m6A_site_411805
mod ID: M6ASITE038497 Click to Show/Hide the Full List
mod site chr19:4174387-4174388:- [3]
Sequence GTGACAGGTGAGCCCCTGCCACACCCCAGCCTCTGACTTGC
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000337491.7; ENST00000601488.5; ENST00000600938.5; ENST00000305232.10; ENST00000599365.5; ENST00000594279.5
External Link RMBase: m6A_site_411806
mod ID: M6ASITE038498 Click to Show/Hide the Full List
mod site chr19:4174418-4174419:- [3]
Sequence TGCGGTTCCGGGAAGAAGCCACACCCCAGAGGTGACAGGTG
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000305232.10; ENST00000601488.5; ENST00000599365.5; ENST00000600938.5; ENST00000337491.7; ENST00000594279.5
External Link RMBase: m6A_site_411807
mod ID: M6ASITE038499 Click to Show/Hide the Full List
mod site chr19:4174483-4174484:- [3]
Sequence TGTGCTCCAGGCCAGGGGTTACACCTGCCCTCCGTGGTCCC
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000601488.5; ENST00000594279.5; ENST00000305232.10; ENST00000599365.5; ENST00000600938.5; ENST00000337491.7
External Link RMBase: m6A_site_411808
mod ID: M6ASITE038500 Click to Show/Hide the Full List
mod site chr19:4174579-4174580:- [2]
Sequence GGGTGGGGCTTTTTGTAGAAACTGTGGATTCTTTTTCTCTC
Motif Score 2.627720238
Cell/Tissue List HeLa; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000601488.5; ENST00000594279.5; ENST00000337491.7; ENST00000600938.5; ENST00000599365.5; ENST00000305232.10
External Link RMBase: m6A_site_411809
mod ID: M6ASITE038501 Click to Show/Hide the Full List
mod site chr19:4174616-4174617:- [4]
Sequence GCCAAGGCGGTCCCCAGCTGACCAGGGTGCTTGGGGAGGGT
Motif Score 2.839113095
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000601488.5; ENST00000337491.7; ENST00000599365.5; ENST00000600938.5; ENST00000594279.5; ENST00000305232.10
External Link RMBase: m6A_site_411810
mod ID: M6ASITE038502 Click to Show/Hide the Full List
mod site chr19:4174655-4174656:- [2]
Sequence ACCAGCCCTGCCCCCCACAGACCCCCCAAAAGGGTGAAGGC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; peripheral-blood; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000337491.7; ENST00000599365.5; ENST00000594279.5; ENST00000596119.5; ENST00000597896.5; ENST00000600938.5; ENST00000601488.5; ENST00000305232.10
External Link RMBase: m6A_site_411811
mod ID: M6ASITE038503 Click to Show/Hide the Full List
mod site chr19:4174944-4174945:- [2]
Sequence CCGTCCCGCCCCTCGGCAGGACCGCCATGCTGACCTCCGCA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; MM6; CD4T; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000601069.5; ENST00000600540.5; ENST00000600938.5; ENST00000597896.5; ENST00000601571.1; ENST00000337491.7; ENST00000601488.5; ENST00000595670.5; ENST00000596119.5; ENST00000599365.5; ENST00000305232.10; ENST00000594279.5
External Link RMBase: m6A_site_411812
mod ID: M6ASITE038504 Click to Show/Hide the Full List
mod site chr19:4175094-4175095:- [2]
Sequence GCAGATCCGGCCCAGCGGGAACCTGCCGCTGGCTACCAAGC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; Jurkat; CD4T; peripheral-blood; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000305232.10; ENST00000594279.5; ENST00000597896.5; ENST00000601571.1; ENST00000599365.5; ENST00000596119.5; ENST00000601069.5; ENST00000600938.5; ENST00000337491.7; ENST00000595670.5; ENST00000601488.5; ENST00000600540.5
External Link RMBase: m6A_site_411813
mod ID: M6ASITE038505 Click to Show/Hide the Full List
mod site chr19:4175224-4175225:- [2]
Sequence CACAGATGGCCTAGGTGTGAACCGGCCCCCAGGGCTGGCTC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000597896.5; ENST00000601571.1; ENST00000600540.5; ENST00000601488.5; ENST00000600938.5; ENST00000599365.5; ENST00000594279.5; ENST00000337491.7; ENST00000596119.5; ENST00000305232.10; ENST00000601069.5; ENST00000595670.5
External Link RMBase: m6A_site_411814
mod ID: M6ASITE038506 Click to Show/Hide the Full List
mod site chr19:4175317-4175318:- [5]
Sequence ATCAATGACCCCGCCAACGGACCGCAGAGGAGGGCAGGGCG
Motif Score 3.622404762
Cell/Tissue List HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000594279.5; ENST00000337491.7; ENST00000596119.5; ENST00000595670.5; ENST00000601488.5; ENST00000599365.5; ENST00000305232.10; ENST00000597896.5; ENST00000601069.5; ENST00000600938.5; ENST00000600540.5; ENST00000601571.1
External Link RMBase: m6A_site_411815
mod ID: M6ASITE038507 Click to Show/Hide the Full List
mod site chr19:4175599-4175600:- [6]
Sequence ACAGCCAGCTCCAGCATGGGACAGTGGCTGAGGCTCACAGG
Motif Score 3.643047619
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000596298.5; ENST00000305232.10; ENST00000601069.5; ENST00000601488.5; ENST00000337491.7; ENST00000600540.5; ENST00000595670.5; ENST00000597896.5; ENST00000594279.5; ENST00000601571.1; ENST00000599365.5; ENST00000600938.5; ENST00000596119.5
External Link RMBase: m6A_site_411816
mod ID: M6ASITE038508 Click to Show/Hide the Full List
mod site chr19:4175621-4175622:- [6]
Sequence GGGGCGGGACGACAGCAGAAACACAGCCAGCTCCAGCATGG
Motif Score 2.20572619
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000601069.5; ENST00000594279.5; ENST00000599365.5; ENST00000597896.5; ENST00000305232.10; ENST00000600540.5; ENST00000337491.7; ENST00000601488.5; ENST00000596298.5; ENST00000596119.5; ENST00000600938.5; ENST00000601571.1; ENST00000595670.5
External Link RMBase: m6A_site_411817
mod ID: M6ASITE038509 Click to Show/Hide the Full List
mod site chr19:4175706-4175707:- [2]
Sequence GGACTCCCTGCCCGACCGGGACCTGGCACTCGCCGATGAGG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000594279.5; ENST00000597896.5; ENST00000305232.10; ENST00000601069.5; ENST00000337491.7; ENST00000600540.5; ENST00000599365.5; ENST00000596298.5; ENST00000600938.5; ENST00000595670.5; ENST00000596119.5; ENST00000601571.1; ENST00000601488.5
External Link RMBase: m6A_site_411818
mod ID: M6ASITE038510 Click to Show/Hide the Full List
mod site chr19:4175724-4175725:- [2]
Sequence CACCATCCTAGACTGGGAGGACTCCCTGCCCGACCGGGACC
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000596119.5; ENST00000601488.5; ENST00000596298.5; ENST00000600938.5; ENST00000595670.5; ENST00000599365.5; ENST00000597896.5; ENST00000601571.1; ENST00000305232.10; ENST00000337491.7; ENST00000600540.5; ENST00000594279.5; ENST00000601069.5
External Link RMBase: m6A_site_411819
mod ID: M6ASITE038511 Click to Show/Hide the Full List
mod site chr19:4175733-4175734:- [2]
Sequence GCTGAGGGACACCATCCTAGACTGGGAGGACTCCCTGCCCG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000337491.7; ENST00000601069.5; ENST00000596298.5; ENST00000601571.1; ENST00000601488.5; ENST00000594279.5; ENST00000596119.5; ENST00000600540.5; ENST00000305232.10; ENST00000600938.5; ENST00000595670.5; ENST00000599365.5; ENST00000597896.5
External Link RMBase: m6A_site_411820
mod ID: M6ASITE038512 Click to Show/Hide the Full List
mod site chr19:4175745-4175746:- [2]
Sequence TTGCAGGGGAGAGCTGAGGGACACCATCCTAGACTGGGAGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; MM6; peripheral-blood; endometrial
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000597896.5; ENST00000601069.5; ENST00000595670.5; ENST00000600540.5; ENST00000596298.5; ENST00000601571.1; ENST00000600938.5; ENST00000337491.7; ENST00000594279.5; ENST00000601488.5; ENST00000305232.10; ENST00000596119.5; ENST00000599365.5
External Link RMBase: m6A_site_411821
mod ID: M6ASITE038513 Click to Show/Hide the Full List
mod site chr19:4175784-4175785:- [2]
Sequence AGGCTGCGAGGCCCCTGAGGACTCTCCTCAGCTTCCTCATT
Motif Score 4.065041667
Cell/Tissue List HeLa; MM6; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000600540.5; ENST00000596298.5; ENST00000601571.1; ENST00000305232.10; ENST00000601488.5; ENST00000599365.5; ENST00000597896.5; ENST00000601069.5; ENST00000595670.5; ENST00000600938.5; ENST00000594279.5; ENST00000337491.7; ENST00000596119.5
External Link RMBase: m6A_site_411822
mod ID: M6ASITE038514 Click to Show/Hide the Full List
mod site chr19:4175922-4175923:- [7]
Sequence ACACAGGCAGTACGTCCGAGACACAGTCGTGGGCACCATGG
Motif Score 2.897386905
Cell/Tissue List HeLa; hESC-HEK293T; MM6
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000600540.5; ENST00000337491.7; ENST00000597896.5; ENST00000601069.5; ENST00000601571.1; ENST00000599365.5; ENST00000594279.5; ENST00000599394.1; ENST00000601488.5; ENST00000596119.5; ENST00000596298.5; ENST00000595670.5; ENST00000305232.10; ENST00000600938.5
External Link RMBase: m6A_site_411823
mod ID: M6ASITE038515 Click to Show/Hide the Full List
mod site chr19:4177111-4177112:- [8]
Sequence ACTGGCAGAGCTCCACGGGAACATGTTTGTGGAAGAATGTG
Motif Score 2.951386905
Cell/Tissue List HepG2; HeLa; hESC-HEK293T; MM6; peripheral-blood; endometrial
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000601488.5; ENST00000597896.5; ENST00000596119.5; ENST00000599365.5; ENST00000337491.7; ENST00000600938.5; ENST00000600540.5; ENST00000595670.5; ENST00000305232.10; ENST00000594279.5; ENST00000599394.1; ENST00000601069.5; ENST00000601571.1; ENST00000596298.5
External Link RMBase: m6A_site_411824
mod ID: M6ASITE038516 Click to Show/Hide the Full List
mod site chr19:4177135-4177136:- [8]
Sequence TTCCTGCTCTTCCCACAGGGACAAACTGGCAGAGCTCCACG
Motif Score 3.643047619
Cell/Tissue List HepG2; HeLa; MM6; peripheral-blood; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000595670.5; ENST00000596119.5; ENST00000600938.5; ENST00000305232.10; ENST00000601069.5; ENST00000600540.5; ENST00000597896.5; ENST00000601571.1; ENST00000601488.5; ENST00000599394.1; ENST00000599365.5; ENST00000596298.5; ENST00000337491.7; ENST00000594279.5
External Link RMBase: m6A_site_411825
mod ID: M6ASITE038517 Click to Show/Hide the Full List
mod site chr19:4179200-4179201:- [2]
Sequence AGAGCGCGCGGCCCACGCAGACCCACATGGCGCTGGTGCAG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq
Transcript ID List ENST00000596298.5; ENST00000600540.5; ENST00000600938.5; ENST00000596119.5; ENST00000337491.7; ENST00000595670.5; ENST00000597896.5; ENST00000601571.1; ENST00000601069.5; ENST00000599365.5; ENST00000305232.10; ENST00000601488.5; ENST00000599394.1; ENST00000594279.5
External Link RMBase: m6A_site_411826
mod ID: M6ASITE038518 Click to Show/Hide the Full List
mod site chr19:4179266-4179267:- [2]
Sequence GGGGTCCCCACGGAGTCTGGACCATGGAGGAGCGAGGTCTG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000595670.5; ENST00000601069.5; ENST00000599365.5; ENST00000597896.5; ENST00000596119.5; ENST00000600540.5; ENST00000596298.5; ENST00000594279.5; ENST00000305232.10; ENST00000601488.5; ENST00000599394.1; ENST00000337491.7; ENST00000600938.5; ENST00000601571.1
External Link RMBase: m6A_site_411827
mod ID: M6ASITE038519 Click to Show/Hide the Full List
mod site chr19:4180867-4180868:- [2]
Sequence CTGGAGCGGAAGGTGTGGGAACTGGCGAGGCTGGTCTGGCA
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; A549; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000305232.10; ENST00000601069.5; ENST00000594279.5; ENST00000597896.5; ENST00000600938.5; ENST00000599365.5; ENST00000594341.1; ENST00000596298.5; ENST00000596119.5; ENST00000595670.5; ENST00000601571.1; ENST00000601488.5; ENST00000600540.5; ENST00000337491.7
External Link RMBase: m6A_site_411828
mod ID: M6ASITE038520 Click to Show/Hide the Full List
mod site chr19:4182498-4182499:- [2]
Sequence GGGGCTGTCGCCGTACGCGGACAAGGGCAAGTGCGGCCTCC
Motif Score 3.643047619
Cell/Tissue List HeLa; hESC-HEK293T; HEK293A-TOA; TIME; TREX
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000596119.5; ENST00000595670.5; ENST00000600540.5; ENST00000601069.5; ENST00000337491.7; ENST00000599365.5; ENST00000597896.5; ENST00000601571.1; ENST00000594341.1; ENST00000600938.5; ENST00000596298.5; ENST00000305232.10; ENST00000601488.5
External Link RMBase: m6A_site_411829