m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00387)
Target Name Solute carrier family 12 member 1 (SLC12A1)
Synonyms
Bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2; Kidney-specific Na-K-Cl symporter; NKCC2
    Click to Show/Hide
Gene Name SLC12A1
Chromosomal Location 15q21.1
Family SLC12A transporter family
Function
Renal sodium, potassium and chloride ion cotransporter that mediates the transepithelial NaCl reabsorption in the thick ascending limb and plays an essential role in the urinary concentration and volume regulation. Electrically silent transporter system.
    Click to Show/Hide
Gene ID 6557
Uniprot ID
S12A1_HUMAN
HGNC ID
HGNC:10910
KEGG ID
hsa:6557
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SLC12A1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Disease
Browse Drug
Acute kidney failure [ICD-11: GB60]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Solute carrier family 12 member 1 (SLC12A1) protein levels and a decrease in FGA and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Responsed Drug Cisplatin Approved
 Drug Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Experiment 2 Reporting the m6A-centered Disease Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Solute carrier family 12 member 1 (SLC12A1) protein levels and a decrease in FGA and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure [ICD-11: GB60]
Responsed Drug Berberine Phase 4
 Drug Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Cisplatin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Solute carrier family 12 member 1 (SLC12A1) protein levels and a decrease in FGA and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
Berberine [Phase 4]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary m6A plays an important role in cisplatin induced acute kidney injury and berberine alleviates this process. Cisplatin induced an increase in Solute carrier family 12 member 1 (SLC12A1) protein levels and a decrease in FGA and Havcr1 protein levels. However, berberine pretreatment reversed these effects.
Responsed Disease Acute kidney failure ICD-11: GB60
 Disease Info 
Cell Process Metabolic processes
Cell death
Cell apoptosis
In-vivo Model This study investigated the N6-methyladenosine (m6A) methylome of kidneys from three mouse groups: C57 mice (controls), those with CI-AKI (injury group, IG), and those pretreated with berberine (treatment group, TG).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00387)
Solute carrier family 12 member 1 (SLC12A1)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006838 Click to Show/Hide the Full List
mod site chr15:48227686-48227687:+ [1]
Sequence CTTTCAAATAATCTAGGAGTAGGCAGGCCTAGGCAGAAAGT
Transcript ID List ENST00000558252.5; ENST00000560692.5; ENST00000561127.5; ENST00000558405.6; ENST00000647546.1; ENST00000330289.10; ENST00000559723.2; ENST00000647232.1; ENST00000646012.1; ENST00000559641.5; ENST00000396577.7; ENST00000380993.7
External Link RMBase: RNA-editing_site_43324
mod ID: A2ISITE006839 Click to Show/Hide the Full List
mod site chr15:48227710-48227711:+ [1]
Sequence AGGCCTAGGCAGAAAGTGAAATGGATGAAATGTATTGTTGT
Transcript ID List ENST00000558252.5; ENST00000561127.5; ENST00000396577.7; ENST00000330289.10; ENST00000647232.1; ENST00000559641.5; ENST00000380993.7; ENST00000559723.2; ENST00000558405.6; ENST00000646012.1; ENST00000560692.5; ENST00000647546.1
External Link RMBase: RNA-editing_site_43325
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE022796 Click to Show/Hide the Full List
mod site chr15:48267591-48267592:+ [2]
Sequence ACTGTGTGTTAAGGAGATGAACAGTGGCATGGCGAAAAAAC
Motif Score 2.951386905
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000646012.1; ENST00000560692.5; ENST00000380993.7; ENST00000647546.1; ENST00000396577.7; ENST00000558252.5; ENST00000647232.1; ENST00000559641.5; ENST00000558405.6
External Link RMBase: m6A_site_276750