m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00372)

Target Name	Protein phosphatase 1A (PPM1A)
Synonyms	Protein phosphatase 2C isoform alpha; PP2C-alpha; Protein phosphatase IA; PPPM1A Click to Show/Hide
Gene Name	PPM1A
Chromosomal Location	14q23.1
Family	PP2C family
Function	Enzyme with a broad specificity. Negatively regulates TGF-beta signaling through dephosphorylating SMAD2 and SMAD3, resulting in their dissociation from SMAD4, nuclear export of the SMADs and termination of the TGF-beta-mediated signaling. Dephosphorylates PRKAA1 and PRKAA2. Plays an important role in the termination of TNF-alpha-mediated NF-kappa-B activation through dephosphorylating and inactivating IKBKB/IKKB. Click to Show/Hide
Gene ID	5494
Uniprot ID	PPM1A_HUMAN
HGNC ID	HGNC:9275
KEGG ID	hsa:5494

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

PPM1A can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	Neural progenitor cell line	Mus musculus
Treatment: METTL14 knockout NPCs Control: Wild type NPCs		GSE158985
Regulation		logFC: 6.97E-01 p-value: 2.44E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone.
Target Regulation	Up regulation
Responsed Disease	Azoospermia		ICD-11: GB04.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shALKBH5 MOLM-13 cells Control: shNS MOLM-13 cells		GSE144968
Regulation		logFC: -9.55E-01 p-value: 2.96E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone.
Target Regulation	Up regulation
Responsed Disease	Azoospermia		ICD-11: GB04.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between PPM1A and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.22E+00	GSE63591

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone. Rapamycin could effectively inhibit phosphorylation of RPS6KB1.
Target Regulation	Up regulation
Responsed Disease	Azoospermia		ICD-11: GB04.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone.
Target Regulation	Up regulation
Responsed Disease	Male infertility		ICD-11: GB04	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.

Male infertility [ICD-11: GB04]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone.
Responsed Disease	Azoospermia [ICD-11: GB04.0]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone.
Responsed Disease	Azoospermia [ICD-11: GB04.0]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone. Rapamycin could effectively inhibit phosphorylation of RPS6KB1.
Responsed Disease	Azoospermia [ICD-11: GB04.0]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.
Experiment 4 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A modification promoted translation of Protein phosphatase 1A (PPM1A) (protein phosphatase 1A, magnesium dependent, alpha isoform), a negative AMP-activated protein kinase (AMPK) regulator, but decreased expression of CAMKK2 (calcium/calmodulin-dependent protein kinase kinase 2, beta), a positive AMPK regulator, by reducing its RNA stability. Similar regulation of METTL14, ALKBH5, and m6A was also observed in LCs upon treatment with human chorionic gonadotropin (HsCG). Knock down of YTHDF1 failed to change the expression of CAMKK2 Providing insight into novel therapeutic strategies by exploiting m6A RNA methylation as targets for treating azoospermatism and oligospermatism patients with reduction in serum testosterone.
Responsed Disease	Male infertility [ICD-11: GB04]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	TM3	Normal	Mus musculus	CVCL_4326
In-vivo Model	Male SPF BALB/c mice (qls02-0202) were purchased from Qinglongshan animal breeding farm. Mice were sacrificed by CO₂ asphyxiation and testes were obtained for following histopathological analyses.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00372)

Protein phosphatase 1A (PPM1A)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000191		Click to Show/Hide the Full List
mod site	chr14:60285690-60285691:+		[2]
Sequence	ACCCAAAGTATCGCCAGAAGCAGTGAAGAAGGAGGCAGAGT
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000325658.3; ENST00000532036.2; ENST00000395076.9; ENST00000531143.6; ENST00000325642.7
External Link	RMBase: ac4C_site_547

Adenosine-to-Inosine editing (A-to-I)

In total 3 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006370		Click to Show/Hide the Full List
mod site	chr14:60256353-60256354:+		[3]
Sequence	TGAGCAGGGGAATTGCTTGAACCCGGGAGGCACAGGTTGCA
Transcript ID List	ENST00000395076.9; ENST00000532036.2; rmsk_4188846; ENST00000528241.2; ENST00000325658.3; ENST00000325642.7; ENST00000525399.2; ENST00000531143.6
External Link	RMBase: RNA-editing_site_38732
mod ID: A2ISITE006371		Click to Show/Hide the Full List
mod site	chr14:60256381-60256382:+		[4]
Sequence	GGCACAGGTTGCAGTGAGCCAAGATTGCATCACTGCATTCT
Transcript ID List	ENST00000531143.6; ENST00000325658.3; ENST00000532036.2; ENST00000525399.2; ENST00000325642.7; rmsk_4188846; ENST00000528241.2; ENST00000395076.9
External Link	RMBase: RNA-editing_site_38733
mod ID: A2ISITE006372		Click to Show/Hide the Full List
mod site	chr14:60275503-60275504:+		[4]
Sequence	TTTATTATTTTTATTTTTTTAGAGACAGAGTCTTACTCTAT
Transcript ID List	ENST00000531937.1; ENST00000528241.2; ENST00000532036.2; ENST00000531143.6; ENST00000395076.9; ENST00000525399.2; ENST00000325658.3; ENST00000325642.7
External Link	RMBase: RNA-editing_site_38734

N6-methyladenosine (m6A)

In total 75 m6A sequence/site(s) in this target gene
mod ID: M6ASITE019804		Click to Show/Hide the Full List
mod site	chr14:60246042-60246043:+		[5]
Sequence	GTGAGAGAAAAAAATATGAAACAGGTAGTGAGGGAGGAAGG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000532036.2; ENST00000531143.6; ENST00000325642.7
External Link	RMBase: m6A_site_249936
mod ID: M6ASITE019805		Click to Show/Hide the Full List
mod site	chr14:60249372-60249373:+		[5]
Sequence	GGGGAGGGGGGGGTGGGGGGACTCTAGACAGCTGAGGCGCG
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; H1B; MT4; Jurkat; CD4T; GSC-11; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000395076.9; ENST00000531143.6; ENST00000532036.2; ENST00000325642.7
External Link	RMBase: m6A_site_249939
mod ID: M6ASITE019806		Click to Show/Hide the Full List
mod site	chr14:60249379-60249380:+		[5]
Sequence	GGGGGGTGGGGGGACTCTAGACAGCTGAGGCGCGAAAGCGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; MT4; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532036.2; ENST00000531143.6; ENST00000395076.9; ENST00000325642.7
External Link	RMBase: m6A_site_249940
mod ID: M6ASITE019807		Click to Show/Hide the Full List
mod site	chr14:60249433-60249434:+		[5]
Sequence	CTTCCTCCTCCTTCTCCGGGACCCGCTCTCTGCCTCCCTCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; MT4; Jurkat; CD4T; GSC-11; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2; ENST00000531143.6; ENST00000325642.7
External Link	RMBase: m6A_site_249941
mod ID: M6ASITE019808		Click to Show/Hide the Full List
mod site	chr14:60249652-60249653:+		[6]
Sequence	GCCGCCTCGGCCGACCAGGGACCTGCCCGCCTGCGGCTGCT
Motif Score	3.622404762
Cell/Tissue List	CD34; HeLa; U2OS; LCLs; MT4; Jurkat; GSC-11; HEK293T; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532036.2; ENST00000531143.6; ENST00000325642.7; ENST00000395076.9; ENST00000325658.3
External Link	RMBase: m6A_site_249942
mod ID: M6ASITE019809		Click to Show/Hide the Full List
mod site	chr14:60250390-60250391:+		[6]
Sequence	TGCTTGTAGATTTTAAATAAACTTGGAGCCTTTTCTTGAAA
Motif Score	2.627720238
Cell/Tissue List	CD34; U2OS; LCLs; MT4; Jurkat; GSC-11; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531143.6; ENST00000528241.2; ENST00000325658.3; ENST00000532036.2; ENST00000325642.7; ENST00000395076.9
External Link	RMBase: m6A_site_249943
mod ID: M6ASITE019810		Click to Show/Hide the Full List
mod site	chr14:60250412-60250413:+		[6]
Sequence	TTGGAGCCTTTTCTTGAAAGACAGCTGGCTGTGGAGAGCCT
Motif Score	2.897386905
Cell/Tissue List	CD34; U2OS; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000325642.7; ENST00000325658.3; ENST00000531143.6; ENST00000532036.2; ENST00000395076.9; ENST00000528241.2
External Link	RMBase: m6A_site_249944
mod ID: M6ASITE019811		Click to Show/Hide the Full List
mod site	chr14:60277056-60277057:+		[6]
Sequence	AATACTAGTGCTGTGATGAGACTCAGCTTGTACTCAAGAAC
Motif Score	3.319380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9; ENST00000531143.6; ENST00000531937.1; ENST00000528241.2; ENST00000525399.2; ENST00000325642.7; ENST00000532036.2; ENST00000325658.3
External Link	RMBase: m6A_site_249945
mod ID: M6ASITE019812		Click to Show/Hide the Full List
mod site	chr14:60277075-60277076:+		[6]
Sequence	GACTCAGCTTGTACTCAAGAACAGATTTATGACTAGGTGAG
Motif Score	2.951386905
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000531937.1; ENST00000395076.9; ENST00000532036.2; ENST00000528241.2; ENST00000325658.3; ENST00000325642.7; ENST00000531143.6; ENST00000525399.2
External Link	RMBase: m6A_site_249946
mod ID: M6ASITE019813		Click to Show/Hide the Full List
mod site	chr14:60277336-60277337:+		[6]
Sequence	TAGTTGGCTGCTTCACCAGGACTCTACAAATTGCTCAGAAC
Motif Score	4.065041667
Cell/Tissue List	CD34; U2OS
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531143.6; ENST00000525399.2; ENST00000325642.7; ENST00000325658.3; ENST00000531937.1; ENST00000532036.2; ENST00000395076.9; ENST00000528241.2
External Link	RMBase: m6A_site_249947
mod ID: M6ASITE019814		Click to Show/Hide the Full List
mod site	chr14:60277355-60277356:+		[5]
Sequence	GACTCTACAAATTGCTCAGAACCCAAGGAGGTAAGATTTTT
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HEK293T; U2OS; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000325658.3; ENST00000525399.2; ENST00000531143.6; ENST00000531937.1; ENST00000528241.2; ENST00000325642.7; ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249948
mod ID: M6ASITE019815		Click to Show/Hide the Full List
mod site	chr14:60282698-60282699:+		[5]
Sequence	TGCAGACCTAGAGGATCAAGACATAATGGGAGCATTTTTAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; U2OS; A549; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000325642.7; ENST00000395076.9; ENST00000325658.3; ENST00000531937.1; ENST00000531143.6; ENST00000525399.2; ENST00000528241.2; ENST00000532036.2
External Link	RMBase: m6A_site_249949
mod ID: M6ASITE019816		Click to Show/Hide the Full List
mod site	chr14:60282719-60282720:+		[5]
Sequence	CATAATGGGAGCATTTTTAGACAAGCCAAAGATGGAAAAGC
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; hESC-HEK293T; U2OS; A549; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; MSC; TIME; TREX; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000325642.7; ENST00000531143.6; ENST00000532036.2; ENST00000528241.2; ENST00000531937.1; ENST00000325658.3; ENST00000525399.2
External Link	RMBase: m6A_site_249950
mod ID: M6ASITE019817		Click to Show/Hide the Full List
mod site	chr14:60282819-60282820:+		[7]
Sequence	CGTGTTGAAATGGAGGATGCACATACGGCTGTGATCGGTTT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000532036.2; ENST00000325642.7; ENST00000525399.2; ENST00000531937.1; ENST00000528241.2; ENST00000531143.6; ENST00000325658.3; ENST00000395076.9
External Link	RMBase: m6A_site_249951
mod ID: M6ASITE019818		Click to Show/Hide the Full List
mod site	chr14:60282849-60282850:+		[5]
Sequence	GTGATCGGTTTGCCAAGTGGACTTGAATCGTGGTCATTCTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; Brain; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531937.1; ENST00000532036.2; ENST00000325642.7; ENST00000325658.3; ENST00000528241.2; ENST00000531143.6; ENST00000395076.9; ENST00000525399.2
External Link	RMBase: m6A_site_249952
mod ID: M6ASITE019819		Click to Show/Hide the Full List
mod site	chr14:60282935-60282936:+		[7]
Sequence	CTGTGAGCATTTGTTAGATCACATCACCAATAACCAGGATT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000528241.2; ENST00000525399.2; ENST00000325658.3; ENST00000532036.2; ENST00000325642.7; ENST00000395076.9; ENST00000531143.6; ENST00000531937.1
External Link	RMBase: m6A_site_249953
mod ID: M6ASITE019820		Click to Show/Hide the Full List
mod site	chr14:60283009-60283010:+		[5]
Sequence	ATGTAAAGAATGGAATCAGAACAGGTTTTCTGGAGATTGAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000528241.2; ENST00000525399.2; ENST00000531937.1; ENST00000531143.6; ENST00000325642.7; ENST00000325658.3; ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249954
mod ID: M6ASITE019821		Click to Show/Hide the Full List
mod site	chr14:60283032-60283033:+		[5]
Sequence	GGTTTTCTGGAGATTGATGAACACATGAGAGTTATGTCAGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000528241.2; ENST00000325658.3; ENST00000325642.7; ENST00000531937.1; ENST00000395076.9; ENST00000532036.2; ENST00000531143.6; ENST00000525399.2
External Link	RMBase: m6A_site_249955
mod ID: M6ASITE019822		Click to Show/Hide the Full List
mod site	chr14:60283059-60283060:+		[5]
Sequence	AGAGTTATGTCAGAGAAGAAACATGGTGCAGATAGAAGTGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000528241.2; ENST00000525399.2; ENST00000532036.2; ENST00000395076.9; ENST00000531937.1; ENST00000325642.7; ENST00000325658.3; ENST00000531143.6
External Link	RMBase: m6A_site_249956
mod ID: M6ASITE019823		Click to Show/Hide the Full List
mod site	chr14:60283084-60283085:+		[8]
Sequence	GTGCAGATAGAAGTGGGTCAACAGCTGTAGGTGTCTTAATT
Motif Score	2.173910714
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000325642.7; ENST00000325658.3; ENST00000525399.2; ENST00000531937.1; ENST00000532036.2; ENST00000531143.6; ENST00000528241.2
External Link	RMBase: m6A_site_249957
mod ID: M6ASITE019824		Click to Show/Hide the Full List
mod site	chr14:60283113-60283114:+		[7]
Sequence	GGTGTCTTAATTTCTCCCCAACATACTTATTTCATTAACTG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T; CD8T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000531143.6; ENST00000525399.2; ENST00000325642.7; ENST00000531937.1; ENST00000532036.2; ENST00000325658.3; ENST00000395076.9
External Link	RMBase: m6A_site_249958
mod ID: M6ASITE019825		Click to Show/Hide the Full List
mod site	chr14:60283130-60283131:+		[9]
Sequence	CCAACATACTTATTTCATTAACTGTGGAGACTCAAGAGGTT
Motif Score	2.590089286
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000531143.6; ENST00000525399.2; ENST00000395076.9; ENST00000325642.7; ENST00000531937.1; ENST00000532036.2; ENST00000325658.3
External Link	RMBase: m6A_site_249959
mod ID: M6ASITE019826		Click to Show/Hide the Full List
mod site	chr14:60283139-60283140:+		[5]
Sequence	TTATTTCATTAACTGTGGAGACTCAAGAGGTTTACTTTGTA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000525399.2; ENST00000531937.1; ENST00000325642.7; ENST00000395076.9; ENST00000531143.6; ENST00000325658.3; ENST00000532036.2
External Link	RMBase: m6A_site_249960
mod ID: M6ASITE019827		Click to Show/Hide the Full List
mod site	chr14:60283163-60283164:+		[5]
Sequence	AAGAGGTTTACTTTGTAGGAACAGGAAAGTTCATTTCTTCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; brain; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000525399.2; ENST00000325642.7; ENST00000325658.3; ENST00000532036.2; ENST00000395076.9; ENST00000531143.6
External Link	RMBase: m6A_site_249961
mod ID: M6ASITE019828		Click to Show/Hide the Full List
mod site	chr14:60283193-60283194:+		[7]
Sequence	TCATTTCTTCACACAAGATCACAAACCAAGTAATCCGCTGG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000532036.2; ENST00000325642.7; ENST00000325658.3; ENST00000531143.6; ENST00000525399.2; ENST00000395076.9
External Link	RMBase: m6A_site_249962
mod ID: M6ASITE019829		Click to Show/Hide the Full List
mod site	chr14:60283197-60283198:+		[5]
Sequence	TTCTTCACACAAGATCACAAACCAAGTAATCCGCTGGAGAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9; ENST00000525399.2; ENST00000325658.3; ENST00000325642.7; ENST00000531143.6
External Link	RMBase: m6A_site_249963
mod ID: M6ASITE019830		Click to Show/Hide the Full List
mod site	chr14:60283307-60283308:+		[7]
Sequence	GGCCCTTGGGGATTTTGATTACAAATGTGTCCATGGAAAAG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000532036.2; ENST00000325658.3; ENST00000395076.9; ENST00000531143.6; ENST00000325642.7
External Link	RMBase: m6A_site_249964
mod ID: M6ASITE019831		Click to Show/Hide the Full List
mod site	chr14:60283473-60283474:+		[6]
Sequence	TGTGATTTTGTAAGATCCAGACTTGAAGTCACTGATGACCT
Motif Score	3.319380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000531143.6; ENST00000532036.2; ENST00000325642.7; ENST00000395076.9; ENST00000325658.3
External Link	RMBase: m6A_site_249965
mod ID: M6ASITE019832		Click to Show/Hide the Full List
mod site	chr14:60285633-60285634:+		[5]
Sequence	TTCTTCCCAGGGAAGTCGAGACAACATGAGTGTGATTTTGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000325658.3; ENST00000531143.6; ENST00000395076.9; ENST00000532036.2; ENST00000325642.7
External Link	RMBase: m6A_site_249966
mod ID: M6ASITE019833		Click to Show/Hide the Full List
mod site	chr14:60285636-60285637:+		[7]
Sequence	TTCCCAGGGAAGTCGAGACAACATGAGTGTGATTTTGATCT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000531143.6; ENST00000325642.7; ENST00000325658.3; ENST00000532036.2
External Link	RMBase: m6A_site_249967
mod ID: M6ASITE019834		Click to Show/Hide the Full List
mod site	chr14:60285714-60285715:+		[5]
Sequence	GAAGAAGGAGGCAGAGTTGGACAAGTACCTGGAATGCAGAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; hESC-HEK293T; hNPCs; peripheral-blood
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000325642.7; ENST00000532036.2; ENST00000531143.6; ENST00000325658.3; ENST00000395076.9
External Link	RMBase: m6A_site_249968
mod ID: M6ASITE019835		Click to Show/Hide the Full List
mod site	chr14:60285800-60285801:+		[10]
Sequence	AAAATCTTCAACACAATCAAACTTTAACATTTTAGCTTTTA
Motif Score	2.627720238
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000531143.6; ENST00000395076.9; ENST00000325658.3; ENST00000532036.2; ENST00000325642.7
External Link	RMBase: m6A_site_249969
mod ID: M6ASITE019836		Click to Show/Hide the Full List
mod site	chr14:60288540-60288541:+		[5]
Sequence	AAAGATTACACAATAAAGGAACTTGGCAAACCAAATCTGAG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000325642.7; ENST00000532036.2; ENST00000395076.9; ENST00000531143.6; ENST00000325658.3
External Link	RMBase: m6A_site_249970
mod ID: M6ASITE019837		Click to Show/Hide the Full List
mod site	chr14:60288549-60288550:+		[5]
Sequence	ACAATAAAGGAACTTGGCAAACCAAATCTGAGATCCTTGCT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000531143.6; ENST00000395076.9; ENST00000325642.7; ENST00000325658.3; ENST00000532036.2
External Link	RMBase: m6A_site_249971
mod ID: M6ASITE019838		Click to Show/Hide the Full List
mod site	chr14:60289858-60289859:+		[7]
Sequence	ACTTAGTCCATGTGATGCGCACATTAGCGAGTGAGAACATC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000531143.6; ENST00000395076.9; ENST00000325642.7; ENST00000532036.2
External Link	RMBase: m6A_site_249972
mod ID: M6ASITE019839		Click to Show/Hide the Full List
mod site	chr14:60289874-60289875:+		[5]
Sequence	GCGCACATTAGCGAGTGAGAACATCCCCAGCCTCCCACCAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2; ENST00000531143.6; ENST00000325642.7
External Link	RMBase: m6A_site_249973
mod ID: M6ASITE019840		Click to Show/Hide the Full List
mod site	chr14:60291419-60291420:+		[7]
Sequence	GAATGTTATTGAAGCCGTTTACAATAGACTGAATCCTTACA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2; ENST00000325642.7; ENST00000531143.6
External Link	RMBase: m6A_site_249974
mod ID: M6ASITE019841		Click to Show/Hide the Full List
mod site	chr14:60291426-60291427:+		[5]
Sequence	ATTGAAGCCGTTTACAATAGACTGAATCCTTACAAAAATGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HEK293T
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2; ENST00000531143.6; ENST00000325642.7
External Link	RMBase: m6A_site_249975
mod ID: M6ASITE019842		Click to Show/Hide the Full List
mod site	chr14:60291437-60291438:+		[11]
Sequence	TTACAATAGACTGAATCCTTACAAAAATGACGACACTGTAA
Motif Score	2.07285119
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000325642.7; ENST00000532036.2; ENST00000395076.9; ENST00000531143.6
External Link	RMBase: m6A_site_249976
mod ID: M6ASITE019843		Click to Show/Hide the Full List
mod site	chr14:60292483-60292484:+		[5]
Sequence	AACAGATGATATGTGGTAAAACTGCTCATCTAGCCATGGAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; fibroblasts
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000325642.7; ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249977
mod ID: M6ASITE019844		Click to Show/Hide the Full List
mod site	chr14:60292548-60292549:+		[5]
Sequence	TACAGCTCAACTTTGTTGAAACTTTTAACATCCATCCTCAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; fibroblasts; A549; Huh7; Jurkat; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000395076.9; ENST00000325642.7; ENST00000532036.2
External Link	RMBase: m6A_site_249978
mod ID: M6ASITE019845		Click to Show/Hide the Full List
mod site	chr14:60292616-60292617:+		[5]
Sequence	GAGAATGATTACATCAGAGAACTTCAGCAGTACAACAGCTA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; hESCs; fibroblasts; A549; LCLs; CD8T; Huh7; Jurkat; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000325642.7; ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249979
mod ID: M6ASITE019846		Click to Show/Hide the Full List
mod site	chr14:60292644-60292645:+		[5]
Sequence	AGTACAACAGCTAGCCCAGAACTGATTTTTTTTTTTTTTTT
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; hESCs; fibroblasts; A549; LCLs; Huh7; Jurkat; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532036.2; ENST00000325642.7; ENST00000395076.9
External Link	RMBase: m6A_site_249980
mod ID: M6ASITE019847		Click to Show/Hide the Full List
mod site	chr14:60292677-60292678:+		[5]
Sequence	TTTTTTTTTGTAAATTTGAGACTTATGTAAGCGTGATTTCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; hESCs; fibroblasts; A549; LCLs; Huh7; Jurkat; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000395076.9; ENST00000325642.7; ENST00000532036.2
External Link	RMBase: m6A_site_249981
mod ID: M6ASITE019848		Click to Show/Hide the Full List
mod site	chr14:60292699-60292700:+		[5]
Sequence	TTATGTAAGCGTGATTTCAAACCATAATTCGTGTTGTAAAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; hESCs; A549; LCLs; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000395076.9; ENST00000325642.7; ENST00000532036.2
External Link	RMBase: m6A_site_249982
mod ID: M6ASITE019849		Click to Show/Hide the Full List
mod site	chr14:60292723-60292724:+		[5]
Sequence	TAATTCGTGTTGTAAATCAGACTCCAGCAATTTTTGTTGTA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; hNPCs; hESCs; A549; LCLs; Huh7
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2; ENST00000325642.7
External Link	RMBase: m6A_site_249983
mod ID: M6ASITE019850		Click to Show/Hide the Full List
mod site	chr14:60292780-60292781:+		[8]
Sequence	TAAAGTGTAATTGTCCTTGTACAAAATGCTCATATTTAATT
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249984
mod ID: M6ASITE019851		Click to Show/Hide the Full List
mod site	chr14:60292805-60292806:+		[12]
Sequence	ATGCTCATATTTAATTATGAACTGCTTTAAATCACTATCAA
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249985
mod ID: M6ASITE019852		Click to Show/Hide the Full List
mod site	chr14:60292830-60292831:+		[8]
Sequence	TTTAAATCACTATCAAAGTTACAAGAAATGTTTGGCTTATT
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249986
mod ID: M6ASITE019853		Click to Show/Hide the Full List
mod site	chr14:60292861-60292862:+		[11]
Sequence	TTGGCTTATTGTGTGATGCAACAGATATATAGCCCTTTCAA
Motif Score	2.173910714
Cell/Tissue List	liver; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249987
mod ID: M6ASITE019854		Click to Show/Hide the Full List
mod site	chr14:60292898-60292899:+		[12]
Sequence	TCAAGTCATGTTGTGTTTGGACTTGGGGTTGGAACAGGGAG
Motif Score	4.065041667
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249988
mod ID: M6ASITE019855		Click to Show/Hide the Full List
mod site	chr14:60292938-60292939:+		[7]
Sequence	GAGCAGCAGCCATGTCAGCTACACGCTCAAATGTGCAGATG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249989
mod ID: M6ASITE019856		Click to Show/Hide the Full List
mod site	chr14:60292985-60292986:+		[7]
Sequence	GAAAATAACCTCAAAATCTTACAAAGCTGAACATCCAAGGA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249990
mod ID: M6ASITE019857		Click to Show/Hide the Full List
mod site	chr14:60292995-60292996:+		[7]
Sequence	TCAAAATCTTACAAAGCTGAACATCCAAGGAGTTATTGAAA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249991
mod ID: M6ASITE019858		Click to Show/Hide the Full List
mod site	chr14:60293016-60293017:+		[8]
Sequence	CATCCAAGGAGTTATTGAAAACTATCTTAAATGTTCTTGGT
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249992
mod ID: M6ASITE019859		Click to Show/Hide the Full List
mod site	chr14:60293078-60293079:+		[8]
Sequence	AAAGCCAGTCCCTTCATTTAACTGTCTTTCAGGATGTTCCT
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249993
mod ID: M6ASITE019860		Click to Show/Hide the Full List
mod site	chr14:60293131-60293132:+		[8]
Sequence	TGAGTATTGCAGGTAATAATACAGTGTATTCATAAGAATCT
Motif Score	2.110482143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249994
mod ID: M6ASITE019861		Click to Show/Hide the Full List
mod site	chr14:60293184-60293185:+		[8]
Sequence	TAAATGCCTTGTTTCTTTGCACCTCTTTTCAAGTCCTTACA
Motif Score	2.809946429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249995
mod ID: M6ASITE019862		Click to Show/Hide the Full List
mod site	chr14:60293202-60293203:+		[8]
Sequence	GCACCTCTTTTCAAGTCCTTACATTTAATTACTAATTGATA
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249996
mod ID: M6ASITE019863		Click to Show/Hide the Full List
mod site	chr14:60293257-60293258:+		[7]
Sequence	ACATATAGTAGGAAACTGCCACATTTTTGCTATCATGATTG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000395076.9; ENST00000532036.2
External Link	RMBase: m6A_site_249997
mod ID: M6ASITE019864		Click to Show/Hide the Full List
mod site	chr14:60293343-60293344:+		[7]
Sequence	TATCAATAAAGCTTGATTTAACAAACAAGAAACTTAATCAT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000532036.2; ENST00000395076.9
External Link	RMBase: m6A_site_249998
mod ID: M6ASITE019865		Click to Show/Hide the Full List
mod site	chr14:60293461-60293462:+		[5]
Sequence	TGTTAGTCTCTTTTAATTGGACAACACTGTCACTCAAGGCA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_249999
mod ID: M6ASITE019866		Click to Show/Hide the Full List
mod site	chr14:60293490-60293491:+		[5]
Sequence	TCACTCAAGGCATAGATGAAACTTTCCTTCCATTAGAAAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250000
mod ID: M6ASITE019867		Click to Show/Hide the Full List
mod site	chr14:60293510-60293511:+		[5]
Sequence	ACTTTCCTTCCATTAGAAAGACTAAAAGATTTAATTCTTGG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250001
mod ID: M6ASITE019868		Click to Show/Hide the Full List
mod site	chr14:60294518-60294519:+		[7]
Sequence	TAGTATAGACTAATTACCAGACATACTGGTACTGAAAGCTA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250002
mod ID: M6ASITE019869		Click to Show/Hide the Full List
mod site	chr14:60294623-60294624:+		[5]
Sequence	ATTGCAAAACTTTGAACTGGACTGTGTAATCTTTTGAGATG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250003
mod ID: M6ASITE019870		Click to Show/Hide the Full List
mod site	chr14:60294648-60294649:+		[5]
Sequence	GTAATCTTTTGAGATGCAAAACTTAAGTCACAAGTAGAGTA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250004
mod ID: M6ASITE019871		Click to Show/Hide the Full List
mod site	chr14:60294692-60294693:+		[5]
Sequence	GATGGAAAGCTGTATTTCAAACCATAACAGCATATTTAGAG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250005
mod ID: M6ASITE019872		Click to Show/Hide the Full List
mod site	chr14:60294735-60294736:+		[5]
Sequence	TTTTTTTTTTGAGTCTTTAAACAAGAGAAAATTAAAATATT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250006
mod ID: M6ASITE019873		Click to Show/Hide the Full List
mod site	chr14:60295950-60295951:+		[5]
Sequence	TAGCATAAGAATAAAATTGGACTGAAGAGGCTTAAGCCCAT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250007
mod ID: M6ASITE019874		Click to Show/Hide the Full List
mod site	chr14:60297603-60297604:+		[8]
Sequence	AGAGTTTTTCTTTTTCTTTTACATAGTCCTCCTGATCCAGT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250008
mod ID: M6ASITE019875		Click to Show/Hide the Full List
mod site	chr14:60297798-60297799:+		[5]
Sequence	GGGGTCACAGGCGTTTTGAGACTGATGAATCCTAGGGACTT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250009
mod ID: M6ASITE019876		Click to Show/Hide the Full List
mod site	chr14:60297815-60297816:+		[5]
Sequence	GAGACTGATGAATCCTAGGGACTTATTTACCCAGGAAAATG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250010
mod ID: M6ASITE019877		Click to Show/Hide the Full List
mod site	chr14:60298113-60298114:+		[7]
Sequence	GATTAAAAGGTGAAAAAAAAACATAGTATTCAGAAGTTTTG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250011
mod ID: M6ASITE019878		Click to Show/Hide the Full List
mod site	chr14:60298193-60298194:+		[11]
Sequence	TTCAACAGAAAAGAGGTAAAACAGAAATGGAATGTATCTGG
Motif Score	2.20572619
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000395076.9
External Link	RMBase: m6A_site_250012

Ref 1	m(6)A mRNA methylation regulates testosterone synthesis through modulating autophagy in Leydig cells. Autophagy. 2021 Feb;17(2):457-475. doi: 10.1080/15548627.2020.1720431. Epub 2020 Jan 31.
Ref 2	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 7	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 9	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 10	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 11	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 12	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map