General Information of the m6A Target Gene (ID: M6ATAR00204)
Target Name Caspase-4 (CASP4)
Synonyms
CASP-4; ICE and Ced-3 homolog 2; ICH-2; ICE(rel)-II; Mih1; Protease TX; ICH2
    Click to Show/Hide
Gene Name CASP4
Chromosomal Location 11q22.3
Family peptidase C14A family
Function
Inflammatory caspase that acts as an essential effector of the NLRP3 and NLRP6 inflammasomes by mediating lipopolysaccharide (LPS)-induced pyroptosis. Thiol protease that cleaves a tetrapeptide after an Asp residue at position P1: catalyzes cleavage of CGAS, GSDMD and IL18. Required for innate immunity to cytosolic, but not vacuolar, bacteria (By similarity). Plays a key role in NLRP3-dependent CASP1 activation and IL1B and IL18 secretion in response to non-canonical activators, such as UVB radiation, cholera enterotoxin subunit B and cytosolic LPS. Activated by direct binding to LPS without the need of an upstream sensor. Involved in NLRP6 inflammasome-dependent activation in response to lipoteichoic acid (LTA), a cell-wall component of Gram-positive bacteria, which leads to CASP1 activation and IL1B and IL18 secretion. Independently of NLRP3 inflammasome and CASP1, promotes pyroptosis, through GSDMD cleavage and activation, followed by IL1A, IL18 and HMGB1 release in response to non-canonical inflammasome activators. Plays a crucial role in the restriction of Salmonella typhimurium replication in colonic epithelial cells during infection: in later stages of the infection, LPS from cytosolic Salmonella triggers CASP4 activation, which catalyzes cleavage of GSDMD, resulting in pyroptosis of infected cells and their extrusion into the gut lumen, as well as in IL18 secretion. Cleavage of GSDMD is not strictly dependent on the consensus cleavage site but depends on an exosite interface on CASP4 that recognizes and binds the Gasdermin-D, C-terminal (GSDMD-CT) part. Pyroptosis limits bacterial replication, while cytokine secretion promotes the recruitment and activation of immune cells and triggers mucosal inflammation. Involved in LPS-induced IL6 secretion; this activity may not require caspase enzymatic activity. Involved in cell death induced by endoplasmic reticulum stress and by treatment with cytotoxic APP peptides found in Alzheimer's patient brains. Catalyzes cleavage and maturation of IL18. In contrast, it does not directly process IL1B. During non-canonical inflammasome activation, cuts CGAS and may play a role in the regulation of antiviral innate immune activation. (Microbial infection) In response to the Td92 surface protein of the periodontal pathogen T.denticola, activated by cathepsin CTSG which leads to production and secretion of IL1A and pyroptosis of gingival fibroblasts.
    Click to Show/Hide
Gene ID 837
Uniprot ID
CASP4_HUMAN
HGNC ID
HGNC:1505
KEGG ID
hsa:837
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CASP4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Disease
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary In lung squamous cell carcinoma, seven m6A-related autophagy genes were screened to construct a prognostic model: Caspase-4 (CASP4), CDKN1A, DLC1, ITGB1, PINK1, TP63, and EIF4EBP1.
Responsed Disease Lung squamous cell carcinoma [ICD-11: 2C25.2]
Pathway Response Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell autophagy
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00204)
Caspase-4 (CASP4)
N6-methyladenosine (m6A)
In total 35 m6A sequence/site(s) in this target gene
mod ID: M6ASITE008331 Click to Show/Hide the Full List
mod site chr11:104943110-104943111:- [2]
Sequence GATCACATTTTGGTGAATAGACTAAGATGTCACAGATGGAA
Motif Score 3.319380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000444739.7; ENST00000533252.1; ENST00000393150.7; ENST00000525116.5; ENST00000529565.1; ENST00000530309.1
External Link RMBase: m6A_site_161565
mod ID: M6ASITE008332 Click to Show/Hide the Full List
mod site chr11:104943193-104943194:- [3]
Sequence AAAATTATTATCTGAGCGAGACAGGAAGCCTTTCTAGTGCT
Motif Score 2.897386905
Cell/Tissue List CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000533252.1; ENST00000444739.7; ENST00000393150.7; ENST00000529565.1; ENST00000525116.5; ENST00000530309.1
External Link RMBase: m6A_site_161566
mod ID: M6ASITE008333 Click to Show/Hide the Full List
mod site chr11:104943220-104943221:- [3]
Sequence TCTATGTTATCACATGGTAAACCTTTAAAAATTATTATCTG
Motif Score 2.185083333
Cell/Tissue List CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000525116.5; ENST00000530309.1; ENST00000393150.7; ENST00000444739.7; ENST00000529565.1; ENST00000533252.1
External Link RMBase: m6A_site_161567
mod ID: M6ASITE008334 Click to Show/Hide the Full List
mod site chr11:104943279-104943280:- [3]
Sequence GAGTGGAGAAAATGGCAGAGACAAATTAGGAGAAGCAGTGA
Motif Score 2.897386905
Cell/Tissue List CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000444739.7; ENST00000525116.5; ENST00000529565.1; ENST00000393150.7; ENST00000530309.1; ENST00000533252.1
External Link RMBase: m6A_site_161568
mod ID: M6ASITE008335 Click to Show/Hide the Full List
mod site chr11:104943322-104943323:- [2]
Sequence GTTTAAAGAACTGCAATGAGACAGTGTGACCAAAAGAGAAC
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000444739.7; ENST00000530309.1; ENST00000525116.5; ENST00000533252.1; ENST00000529565.1; ENST00000393150.7
External Link RMBase: m6A_site_161569
mod ID: M6ASITE008336 Click to Show/Hide the Full List
mod site chr11:104943333-104943334:- [2]
Sequence GCACTAAACATGTTTAAAGAACTGCAATGAGACAGTGTGAC
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000444739.7; ENST00000393150.7; ENST00000530309.1; ENST00000525116.5; ENST00000533252.1; ENST00000529565.1
External Link RMBase: m6A_site_161570
mod ID: M6ASITE008337 Click to Show/Hide the Full List
mod site chr11:104943346-104943347:- [2]
Sequence CTGGGATAGCAATGCACTAAACATGTTTAAAGAACTGCAAT
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000533252.1; ENST00000530309.1; ENST00000444739.7; ENST00000393150.7; ENST00000525116.5; ENST00000529565.1
External Link RMBase: m6A_site_161571
mod ID: M6ASITE008338 Click to Show/Hide the Full List
mod site chr11:104943443-104943444:- [2]
Sequence GAAATCAGAACAAAGAATGGACAGAGTTGGGGAGTGAATAA
Motif Score 3.643047619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000525116.5; ENST00000530309.1; ENST00000444739.7; ENST00000533252.1; ENST00000529565.1; ENST00000393150.7
External Link RMBase: m6A_site_161572
mod ID: M6ASITE008339 Click to Show/Hide the Full List
mod site chr11:104943454-104943455:- [2]
Sequence CTTGAAATAATGAAATCAGAACAAAGAATGGACAGAGTTGG
Motif Score 2.951386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000525116.5; ENST00000444739.7; ENST00000530309.1; ENST00000393150.7; ENST00000529565.1; ENST00000533252.1
External Link RMBase: m6A_site_161573
mod ID: M6ASITE008340 Click to Show/Hide the Full List
mod site chr11:104943526-104943527:- [2]
Sequence ATAAAGGAAGACAAAGGAAAACACAGAATGATGGATGCTGT
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000444739.7; ENST00000529565.1; ENST00000533252.1; ENST00000525116.5; ENST00000393150.7; ENST00000530309.1
External Link RMBase: m6A_site_161574
mod ID: M6ASITE008341 Click to Show/Hide the Full List
mod site chr11:104943536-104943537:- [2]
Sequence AAAAGGAAAAATAAAGGAAGACAAAGGAAAACACAGAATGA
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000393150.7; ENST00000533252.1; ENST00000529565.1; ENST00000444739.7; ENST00000530309.1; ENST00000525116.5
External Link RMBase: m6A_site_161575
mod ID: M6ASITE008342 Click to Show/Hide the Full List
mod site chr11:104948561-104948562:- [4]
Sequence CAAGACCCACGTGGAGAAGGACTTCATTGCTTTCTGCTCTT
Motif Score 4.065041667
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000534356.1; ENST00000393150.7; ENST00000533730.5; ENST00000444739.7; ENST00000529565.1; ENST00000525116.5
External Link RMBase: m6A_site_161576
mod ID: M6ASITE008343 Click to Show/Hide the Full List
mod site chr11:104948577-104948578:- [4]
Sequence AGGAAGATGCTGTTTACAAGACCCACGTGGAGAAGGACTTC
Motif Score 2.876744048
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000525116.5; ENST00000444739.7; ENST00000529565.1; ENST00000534356.1; ENST00000393150.7; ENST00000533730.5
External Link RMBase: m6A_site_161577
mod ID: M6ASITE008344 Click to Show/Hide the Full List
mod site chr11:104948603-104948604:- [4]
Sequence CTCTTCACAGTCATCTGAGAACCTAGAGGAAGATGCTGTTT
Motif Score 2.930744048
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000529565.1; ENST00000529183.5; ENST00000533730.5; ENST00000534356.1; ENST00000393150.7; ENST00000444739.7; ENST00000525116.5
External Link RMBase: m6A_site_161578
mod ID: M6ASITE008345 Click to Show/Hide the Full List
mod site chr11:104948648-104948649:- [4]
Sequence TGGGGAACTGTGGGTCAGAGACTCTCCAGCATCCTTGGAAG
Motif Score 3.319380952
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000525116.5; ENST00000529183.5; ENST00000393150.7; ENST00000534356.1; ENST00000444739.7; ENST00000533730.5; ENST00000529565.1
External Link RMBase: m6A_site_161579
mod ID: M6ASITE008346 Click to Show/Hide the Full List
mod site chr11:104948662-104948663:- [4]
Sequence TCCATAGCAAACCGTGGGGAACTGTGGGTCAGAGACTCTCC
Motif Score 3.373380952
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000534356.1; ENST00000529183.5; ENST00000393150.7; ENST00000529565.1; ENST00000525116.5; ENST00000444739.7; ENST00000533730.5
External Link RMBase: m6A_site_161580
mod ID: M6ASITE008347 Click to Show/Hide the Full List
mod site chr11:104948672-104948673:- [4]
Sequence AGTTAATGTCTCCATAGCAAACCGTGGGGAACTGTGGGTCA
Motif Score 2.185083333
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000533730.5; ENST00000529183.5; ENST00000529565.1; ENST00000534356.1; ENST00000525116.5; ENST00000393150.7; ENST00000444739.7
External Link RMBase: m6A_site_161581
mod ID: M6ASITE008348 Click to Show/Hide the Full List
mod site chr11:104949162-104949163:- [2]
Sequence AACTGGGGCCATTATGTAAAACAGCATCCCTTTTTCTTATA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000529565.1; ENST00000444739.7; ENST00000533730.5; ENST00000529183.5; ENST00000393150.7
External Link RMBase: m6A_site_161582
mod ID: M6ASITE008349 Click to Show/Hide the Full List
mod site chr11:104949181-104949182:- [2]
Sequence TGAGAAGAATTTCATTTGAAACTGGGGCCATTATGTAAAAC
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000444739.7; ENST00000529565.1; ENST00000529183.5; ENST00000533730.5; ENST00000393150.7
External Link RMBase: m6A_site_161583
mod ID: M6ASITE008350 Click to Show/Hide the Full List
mod site chr11:104949580-104949581:- [4]
Sequence CAACTGCCTCAGTCTGAAGGACAAACCCAAGGTCATCATTG
Motif Score 3.643047619
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000529565.1; ENST00000529183.5; ENST00000524843.5; ENST00000533730.5; ENST00000444739.7; ENST00000393150.7
External Link RMBase: m6A_site_161584
mod ID: M6ASITE008351 Click to Show/Hide the Full List
mod site chr11:104949648-104949649:- [5]
Sequence ACTGTGCATGATGAGAAAAAACCAGATGTGCTGCTTTATGA
Motif Score 2.185083333
Cell/Tissue List HeLa; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000533730.5; ENST00000524843.5; ENST00000393150.7; ENST00000529183.5; ENST00000444739.7; ENST00000529565.1
External Link RMBase: m6A_site_161585
mod ID: M6ASITE008352 Click to Show/Hide the Full List
mod site chr11:104949668-104949669:- [5]
Sequence TCCTGGAGGGAATCTGCGGAACTGTGCATGATGAGAAAAAA
Motif Score 3.373380952
Cell/Tissue List HeLa; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000533730.5; ENST00000524843.5; ENST00000529183.5; ENST00000393150.7; ENST00000444739.7; ENST00000531333.5; ENST00000529565.1
External Link RMBase: m6A_site_161586
mod ID: M6ASITE008353 Click to Show/Hide the Full List
mod site chr11:104949741-104949742:- [5]
Sequence CTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGA
Motif Score 2.876744048
Cell/Tissue List HeLa; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000393150.7; ENST00000533730.5; ENST00000524843.5; ENST00000529183.5; ENST00000444739.7; ENST00000531333.5; ENST00000529565.1
External Link RMBase: m6A_site_161587
mod ID: M6ASITE008354 Click to Show/Hide the Full List
mod site chr11:104950961-104950962:- [6]
Sequence GGAGCTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAG
Motif Score 4.065041667
Cell/Tissue List peripheral-blood; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000393150.7; ENST00000529183.5; ENST00000533730.5; ENST00000524843.5; ENST00000444739.7; ENST00000531333.5; ENST00000529565.1
External Link RMBase: m6A_site_161588
mod ID: M6ASITE008355 Click to Show/Hide the Full List
mod site chr11:104951075-104951076:- [2]
Sequence CTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTC
Motif Score 2.20572619
Cell/Tissue List Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000393150.7; ENST00000529183.5; ENST00000533730.5; ENST00000531333.5; ENST00000524843.5; ENST00000417440.2; ENST00000444739.7
External Link RMBase: m6A_site_161589
mod ID: M6ASITE008356 Click to Show/Hide the Full List
mod site chr11:104951439-104951440:- [2]
Sequence CTATGCTTCCGAAGGCAAAGACTTTTGCTGTATTCATTTTT
Motif Score 3.319380952
Cell/Tissue List Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000529183.5; ENST00000417440.2; ENST00000533730.5; ENST00000524843.5; ENST00000393150.7; ENST00000531546.1; ENST00000531333.5; ENST00000444739.7
External Link RMBase: m6A_site_161590
mod ID: M6ASITE008357 Click to Show/Hide the Full List
mod site chr11:104954769-104954770:- [2]
Sequence TCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAA
Motif Score 2.876744048
Cell/Tissue List Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000529183.5; ENST00000417440.2; ENST00000533730.5; ENST00000524843.5; ENST00000531333.5; ENST00000393150.7; ENST00000531546.1; ENST00000444739.7
External Link RMBase: m6A_site_161591
mod ID: M6ASITE008358 Click to Show/Hide the Full List
mod site chr11:104954785-104954786:- [5]
Sequence CAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAA
Motif Score 2.185083333
Cell/Tissue List HeLa; A549; Huh7; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000531546.1; ENST00000533730.5; ENST00000393150.7; ENST00000529183.5; ENST00000417440.2; ENST00000444739.7; ENST00000524843.5; ENST00000531333.5
External Link RMBase: m6A_site_161592
mod ID: M6ASITE008359 Click to Show/Hide the Full List
mod site chr11:104954801-104954802:- [5]
Sequence GAGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTT
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; Huh7; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000529183.5; ENST00000417440.2; ENST00000393150.7; ENST00000524843.5; ENST00000531546.1; ENST00000444739.7; ENST00000531333.5; ENST00000533730.5
External Link RMBase: m6A_site_161593
mod ID: M6ASITE008360 Click to Show/Hide the Full List
mod site chr11:104954832-104954833:- [5]
Sequence CAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAAC
Motif Score 3.319380952
Cell/Tissue List HeLa; A549; LCLs; MM6; Huh7; MSC; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000417440.2; ENST00000529183.5; ENST00000531333.5; ENST00000444739.7; ENST00000533730.5; ENST00000531546.1; ENST00000524843.5; ENST00000393150.7
External Link RMBase: m6A_site_161594
mod ID: M6ASITE008361 Click to Show/Hide the Full List
mod site chr11:104954853-104954854:- [5]
Sequence TTACGATGCTAAAACTGAAGACAAAGTTCGGGTCATGGCAG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; LCLs; MM6; Huh7; peripheral-blood; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000531333.5; ENST00000529183.5; ENST00000533730.5; ENST00000417440.2; ENST00000531546.1; ENST00000393150.7; ENST00000524843.5; ENST00000444739.7
External Link RMBase: m6A_site_161595
mod ID: M6ASITE008362 Click to Show/Hide the Full List
mod site chr11:104954860-104954861:- [5]
Sequence AGAAATATTACGATGCTAAAACTGAAGACAAAGTTCGGGTC
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; A549; LCLs; MM6; Huh7; peripheral-blood; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000531546.1; ENST00000531333.5; ENST00000444739.7; ENST00000529183.5; ENST00000533730.5; ENST00000524843.5; ENST00000417440.2; ENST00000393150.7
External Link RMBase: m6A_site_161596
mod ID: M6ASITE008363 Click to Show/Hide the Full List
mod site chr11:104954901-104954902:- [7]
Sequence GGTGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAA
Motif Score 3.373380952
Cell/Tissue List HepG2; HeLa; A549; fibroblasts; LCLs; MM6; Huh7; peripheral-blood; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524843.5; ENST00000444739.7; ENST00000533730.5; ENST00000531333.5; ENST00000417440.2; ENST00000529183.5; ENST00000531546.1; ENST00000393150.7
External Link RMBase: m6A_site_161597
mod ID: M6ASITE008364 Click to Show/Hide the Full List
mod site chr11:104954915-104954916:- [7]
Sequence GTTTTGGATAACTTGGTGGAACAAAATGTACTGAACTGGAA
Motif Score 2.951386905
Cell/Tissue List HepG2; HeLa; A549; hESC-HEK293T; fibroblasts; LCLs; MM6; Huh7; peripheral-blood; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000533730.5; ENST00000531546.1; ENST00000444739.7; ENST00000524843.5; ENST00000531333.5; ENST00000393150.7; ENST00000417440.2; ENST00000529183.5
External Link RMBase: m6A_site_161598
mod ID: M6ASITE008365 Click to Show/Hide the Full List
mod site chr11:104968540-104968541:- [8]
Sequence TTCCAACGCTGTAAAAAAGGACAGAGGCTGTTCCCTATGGC
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000531546.1; ENST00000444739.7; ENST00000529183.5; ENST00000533730.5; ENST00000524843.5; ENST00000417440.2; ENST00000531333.5
External Link RMBase: m6A_site_161599