m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00193)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
AURKB
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5 | ||
| Cell Line | HaCAT cell line | Homo sapiens |
|
Treatment: siALKBH5 HaCAT cells
Control: siControl HaCAT cells
|
GSE211076 | |
| Regulation |
![]() ![]() |
logFC: 9.68E-01 p-value: 1.88E-24 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | ALKBH5 plays a carcinogenic role in renal cell carcinoma by stabilizing Aurora kinase B (AURKB) mRNA in a m6A-dependent manner. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Renal cell carcinoma | ICD-11: 2C90 | ||
| Pathway Response | HIF-1 signaling pathway | hsa04066 | ||
| Cell Process | Cell proliferation | |||
| Cell colony formation | ||||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 769-P | Renal cell carcinoma | Homo sapiens | CVCL_1050 |
| 786-O | Renal cell carcinoma | Homo sapiens | CVCL_1051 | |
| ACHN | Papillary renal cell carcinoma | Homo sapiens | CVCL_1067 | |
| Caki-1 | Clear cell renal cell carcinoma | Homo sapiens | CVCL_0234 | |
| Caki-2 | Papillary renal cell carcinoma | Homo sapiens | CVCL_0235 | |
| HK2 | Normal | Acipenser baerii | CVCL_YE28 | |
| In-vivo Model | The nude mice were randomly grouped into 2 groups, of 5 mice each; 786-0 cells (7×106 in 100 L PBS) were stabilized with ALKBH5 knockdown lentiviral transfection vector (shALKBH5) or scramble vector (SCR) via subcutaneous injection into the left armpit of each mouse. | |||
Renal cell carcinoma [ICD-11: 2C90]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | ALKBH5 plays a carcinogenic role in renal cell carcinoma by stabilizing Aurora kinase B (AURKB) mRNA in a m6A-dependent manner. | |||
| Responsed Disease | Renal cell carcinoma [ICD-11: 2C90] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | HIF-1 signaling pathway | hsa04066 | ||
| Cell Process | Cell proliferation | |||
| Cell colony formation | ||||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 769-P | Renal cell carcinoma | Homo sapiens | CVCL_1050 |
| 786-O | Renal cell carcinoma | Homo sapiens | CVCL_1051 | |
| ACHN | Papillary renal cell carcinoma | Homo sapiens | CVCL_1067 | |
| Caki-1 | Clear cell renal cell carcinoma | Homo sapiens | CVCL_0234 | |
| Caki-2 | Papillary renal cell carcinoma | Homo sapiens | CVCL_0235 | |
| HK2 | Normal | Acipenser baerii | CVCL_YE28 | |
| In-vivo Model | The nude mice were randomly grouped into 2 groups, of 5 mice each; 786-0 cells (7×106 in 100 L PBS) were stabilized with ALKBH5 knockdown lentiviral transfection vector (shALKBH5) or scramble vector (SCR) via subcutaneous injection into the left armpit of each mouse. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00193)
| In total 15 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE030299 | Click to Show/Hide the Full List | ||
| mod site | chr17:8204987-8204988:- | [2] | |
| Sequence | GCCCAGGACCTCATCTCCAAACTGCTCAGGCATAACCCCTC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000584972.5; ENST00000578753.1; ENST00000316199.10; ENST00000585124.6; ENST00000578549.5; ENST00000580998.5; ENST00000534871.5 | ||
| External Link | RMBase: m6A_site_347377 | ||
| mod ID: M6ASITE030300 | Click to Show/Hide the Full List | ||
| mod site | chr17:8205000-8205001:- | [3] | |
| Sequence | CGTGCCCATGGGAGCCCAGGACCTCATCTCCAAACTGCTCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000580998.5; ENST00000316199.10; ENST00000534871.5; ENST00000585124.6; ENST00000578549.5; ENST00000578753.1; ENST00000584972.5 | ||
| External Link | RMBase: m6A_site_347378 | ||
| mod ID: M6ASITE030301 | Click to Show/Hide the Full List | ||
| mod site | chr17:8205039-8205040:- | [3] | |
| Sequence | CTCTTCACACCTGCAGGTGGACCTAAAGTTCCCCGCTTCCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000578549.5; ENST00000585124.6; ENST00000580998.5; ENST00000316199.10; ENST00000578753.1; ENST00000584972.5; ENST00000534871.5 | ||
| External Link | RMBase: m6A_site_347379 | ||
| mod ID: M6ASITE030302 | Click to Show/Hide the Full List | ||
| mod site | chr17:8205235-8205236:- | [3] | |
| Sequence | AGAGTGCATCACACAACGAGACCTATCGCCGCATCGTCAAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000578753.1; ENST00000580998.5; ENST00000578549.5; ENST00000534871.5; ENST00000316199.10; ENST00000584972.5; ENST00000585124.6 | ||
| External Link | RMBase: m6A_site_347380 | ||
| mod ID: M6ASITE030303 | Click to Show/Hide the Full List | ||
| mod site | chr17:8205267-8205268:- | [4] | |
| Sequence | CTATGAGCTGCTGGTGGGGAACCCACCCTTTGAGAGTGCAT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | MM6; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000578753.1; ENST00000534871.5; ENST00000577833.5; ENST00000585124.6; ENST00000578549.5; ENST00000580998.5; ENST00000584972.5; ENST00000316199.10 | ||
| External Link | RMBase: m6A_site_347381 | ||
| mod ID: M6ASITE030304 | Click to Show/Hide the Full List | ||
| mod site | chr17:8205363-8205364:- | [4] | |
| Sequence | GACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | MM6; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000585124.6; ENST00000580998.5; ENST00000534871.5; ENST00000578549.5; ENST00000316199.10; ENST00000578753.1; ENST00000577833.5; ENST00000584972.5 | ||
| External Link | RMBase: m6A_site_347382 | ||
| mod ID: M6ASITE030305 | Click to Show/Hide the Full List | ||
| mod site | chr17:8205382-8205383:- | [4] | |
| Sequence | TTATCCCTCCCAGGAGGAAGACAATGTGTGGCACCCTGGAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MM6; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000584972.5; ENST00000316199.10; ENST00000578753.1; ENST00000580998.5; ENST00000585124.6; ENST00000577833.5; ENST00000534871.5; ENST00000578549.5 | ||
| External Link | RMBase: m6A_site_347383 | ||
| mod ID: M6ASITE030306 | Click to Show/Hide the Full List | ||
| mod site | chr17:8206577-8206578:- | [4] | |
| Sequence | GAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MM6; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000584972.5; ENST00000581511.5; ENST00000585124.6; ENST00000577833.5; ENST00000582368.5; ENST00000578753.1; ENST00000578549.5; ENST00000580998.5; ENST00000580390.5; ENST00000316199.10; ENST00000534871.5; ENST00000584561.1 | ||
| External Link | RMBase: m6A_site_347384 | ||
| mod ID: M6ASITE030307 | Click to Show/Hide the Full List | ||
| mod site | chr17:8207586-8207587:- | [5] | |
| Sequence | TGATGGAGAATAGCAGTGGGACACCCGACATCTTAACGTAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; MT4; A549; MM6; Jurkat; peripheral-blood; iSLK; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000582368.5; ENST00000534871.5; ENST00000581511.5; ENST00000584561.1; ENST00000316199.10; ENST00000577833.5; ENST00000578549.5; ENST00000580998.5; ENST00000583915.1; ENST00000580390.5; ENST00000585124.6 | ||
| External Link | RMBase: m6A_site_347385 | ||
| mod ID: M6ASITE030308 | Click to Show/Hide the Full List | ||
| mod site | chr17:8207878-8207879:- | [5] | |
| Sequence | CATTCCACCCCGGTCATCAGACAAAGGCACCCTCAGAGCTA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000582368.5; ENST00000577833.5; ENST00000534871.5; ENST00000316199.10; ENST00000581511.5; ENST00000580998.5; ENST00000584561.1; ENST00000580390.5; ENST00000585124.6; ENST00000583915.1; ENST00000578549.5 | ||
| External Link | RMBase: m6A_site_347386 | ||
| mod ID: M6ASITE030309 | Click to Show/Hide the Full List | ||
| mod site | chr17:8207982-8207983:- | [5] | |
| Sequence | AGCAGAGGCTGGGAAGCAAAACTGTCACATCAGTGTTTCTC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000582368.5; ENST00000580390.5; ENST00000584561.1; ENST00000585124.6; ENST00000580998.5; ENST00000577833.5; ENST00000534871.5; ENST00000581511.5; ENST00000583915.1; ENST00000316199.10; ENST00000578549.5 | ||
| External Link | RMBase: m6A_site_347387 | ||
| mod ID: M6ASITE030310 | Click to Show/Hide the Full List | ||
| mod site | chr17:8210029-8210030:- | [5] | |
| Sequence | GTCCCAAGTTTGACGACAGAACCCGCTCTGGTCATTTGTAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000584561.1; ENST00000581511.5; ENST00000577833.5; ENST00000582368.5; ENST00000585124.6; ENST00000583915.1; ENST00000316199.10; ENST00000578549.5; ENST00000534871.5; ENST00000583124.1; ENST00000580998.5 | ||
| External Link | RMBase: m6A_site_347388 | ||
| mod ID: M6ASITE030311 | Click to Show/Hide the Full List | ||
| mod site | chr17:8210113-8210114:- | [5] | |
| Sequence | TGGCGAGTTCCTGCTGGGAAACTTGAGATCCTGCAATGAGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000583124.1; ENST00000581511.5; ENST00000582368.5; ENST00000578549.5; ENST00000584561.1; ENST00000585124.6; ENST00000316199.10; ENST00000534871.5; ENST00000583915.1; ENST00000580998.5; ENST00000577833.5 | ||
| External Link | RMBase: m6A_site_347389 | ||
| mod ID: M6ASITE030312 | Click to Show/Hide the Full List | ||
| mod site | chr17:8210207-8210208:- | [5] | |
| Sequence | AAGGATGGCCCAGAAGGAGAACTCCTACCCCTGGCCCTACG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; U2OS; H1B; hESCs; HEK293T; fibroblasts; A549; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000583915.1; ENST00000583124.1; ENST00000585124.6; ENST00000316199.10; ENST00000534871.5; ENST00000582368.5; ENST00000580998.5; ENST00000577833.5; ENST00000578549.5; ENST00000584561.1; ENST00000581511.5 | ||
| External Link | RMBase: m6A_site_347390 | ||
| mod ID: M6ASITE030313 | Click to Show/Hide the Full List | ||
| mod site | chr17:8210535-8210536:- | [5] | |
| Sequence | GGAGAGTAGCAGTGCCTTGGACCCCAGGTGAGCTGGCCTCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; U2OS; H1B; hESCs; HEK293T; fibroblasts; A549; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000583915.1; ENST00000584561.1; ENST00000316199.10; ENST00000585124.6; ENST00000583124.1; ENST00000534871.5; ENST00000577833.5; ENST00000581511.5 | ||
| External Link | RMBase: m6A_site_347391 | ||
References

