m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00174)

Target Name	Aldo-keto reductase family 1 member C1 (AKR1C1)
Synonyms	20-alpha-hydroxysteroid dehydrogenase; 20-alpha-HSD; Chlordecone reductase homolog HAKRC; Dihydrodiol dehydrogenase 1; DD1; High-affinity hepatic bile acid-binding protein; HBAB; DDH; DDH1 Click to Show/Hide
Gene Name	AKR1C1
Chromosomal Location	10p15.1
Family	aldo/keto reductase family
Function	Cytosolic aldo-keto reductase that catalyzes the NADH and NADPH-dependent reduction of ketosteroids to hydroxysteroids. Most probably acts as a reductase in vivo since the oxidase activity measured in vitro is inhibited by physiological concentrations of NADPH. Displays a broad positional specificity acting on positions 3, 17 and 20 of steroids and regulates the metabolism of hormones like estrogens and androgens. May also reduce conjugated steroids such as 5alpha-dihydrotestosterone sulfate. Displays affinity for bile acids. Click to Show/Hide
Gene ID	1645
Uniprot ID	AK1C1_HUMAN
HGNC ID	HGNC:384
KEGG ID	hsa:1645

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

AKR1C1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-Aldo-keto reductase family 1 member C1 (AKR1C1) axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-Aldo-keto reductase family 1 member C1 (AKR1C1) axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-Aldo-keto reductase family 1 member C1 (AKR1C1) axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Chemical carcinogenesis - reactive oxygen species			hsa05208
Pathway Response	Cell cycle			hsa04110
Cell Process	Biological regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
	GLC-82	Endocervical adenocarcinoma	Homo sapiens	CVCL_3371
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	HEK293T	Normal	Homo sapiens	CVCL_0063
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
	SPC-A1	Endocervical adenocarcinoma	Homo sapiens	CVCL_6955
In-vivo Model	Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 10⁶ p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00174)

Aldo-keto reductase family 1 member C1 (AKR1C1)

N6-methyladenosine (m6A)

In total 23 m6A sequence/site(s) in this target gene
mod ID: M6ASITE095326		Click to Show/Hide the Full List
mod site	chr10:4963353-4963354:+		[2]
Sequence	TGCCATTGGTTAACCAGCAGACAGTGTGCTCAGGGGCGTTG
Motif Score	2.897386905
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000477661.1
External Link	RMBase: m6A_site_90754
mod ID: M6ASITE095327		Click to Show/Hide the Full List
mod site	chr10:4963416-4963417:+		[2]
Sequence	TGTGAGGGAGGAAGAAAGAAACATTTGCCAGCCAGGCTAGT
Motif Score	2.20572619
Cell/Tissue List	A549; Huh7; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380872.9; ENST00000477661.1
External Link	RMBase: m6A_site_90755
mod ID: M6ASITE095328		Click to Show/Hide the Full List
mod site	chr10:4963438-4963439:+		[3]
Sequence	ATTTGCCAGCCAGGCTAGTGACAGAAATGGATTCGAAATAT
Motif Score	2.859755952
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000477661.1; ENST00000380872.9
External Link	RMBase: m6A_site_90756
mod ID: M6ASITE095329		Click to Show/Hide the Full List
mod site	chr10:4963838-4963839:+		[4]
Sequence	CTGTTTCTTTGTATAGTCGAACAGATATTTACTTCTTCCAA
Motif Score	2.951386905
Cell/Tissue List	A549; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000477661.1; ENST00000380859.1; ENST00000380872.9; ENST00000442997.5
External Link	RMBase: m6A_site_90757
mod ID: M6ASITE095330		Click to Show/Hide the Full List
mod site	chr10:4981286-4981287:+		[5]
Sequence	ATTGTTAGAATAGTAAATGAACATCATATGTTGTAATATAG
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380872.9
External Link	RMBase: m6A_site_90760
mod ID: M6ASITE095331		Click to Show/Hide the Full List
mod site	chr10:4981351-4981352:+		[5]
Sequence	TACAAGAAATAATTTTAAAAACTACTCAAAGAAATCAGAGA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_3224386; ENST00000380872.9
External Link	RMBase: m6A_site_90761
mod ID: M6ASITE095332		Click to Show/Hide the Full List
mod site	chr10:4981389-4981390:+		[5]
Sequence	AGATATCACAAAATGACAAAACAAGTACAGGGGCAGCAAAA
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380872.9; rmsk_3224386
External Link	RMBase: m6A_site_90762
mod ID: M6ASITE095333		Click to Show/Hide the Full List
mod site	chr10:4981444-4981445:+		[5]
Sequence	ACTATGAGATCTCATCAAGAACTAAGAAAATGGAGAAAAGT
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380872.9
External Link	RMBase: m6A_site_90763
mod ID: M6ASITE095334		Click to Show/Hide the Full List
mod site	chr10:4982374-4982375:+		[6]
Sequence	CGCCCCACCCCCCTCCCTGGACAGCCCAGCTACAATTGTCT
Motif Score	3.643047619
Cell/Tissue List	TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380872.9
External Link	RMBase: m6A_site_90764
mod ID: M6ASITE095335		Click to Show/Hide the Full List
mod site	chr10:4982399-4982400:+		[6]
Sequence	CCAGCTACAATTGTCTGAGAACTCACTGCAAGCTGTAAGCG
Motif Score	3.373380952
Cell/Tissue List	TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380872.9
External Link	RMBase: m6A_site_90765
mod ID: M6ASITE095336		Click to Show/Hide the Full List
mod site	chr10:4982448-4982449:+		[2]
Sequence	CTTCCCACTCCCTTTTTTGAACTCTTCTGTGCAGCAGAGGC
Motif Score	3.373380952
Cell/Tissue List	A549; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380872.9
External Link	RMBase: m6A_site_90766
mod ID: M6ASITE095337		Click to Show/Hide the Full List
mod site	chr10:4982475-4982476:+		[2]
Sequence	TGTGCAGCAGAGGCAATTAAACTCTCCTCTGGAACATTACC
Motif Score	2.627720238
Cell/Tissue List	A549; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380872.9; rmsk_3224389
External Link	RMBase: m6A_site_90767
mod ID: M6ASITE095338		Click to Show/Hide the Full List
mod site	chr10:4982488-4982489:+		[2]
Sequence	CAATTAAACTCTCCTCTGGAACATTACCCCAGCAGCCTGAG
Motif Score	2.951386905
Cell/Tissue List	A549; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_3224389; ENST00000380872.9
External Link	RMBase: m6A_site_90768
mod ID: M6ASITE095339		Click to Show/Hide the Full List
mod site	chr10:4982510-4982511:+		[2]
Sequence	ATTACCCCAGCAGCCTGAGAACCACCCCTTGGCGCTCACAG
Motif Score	2.930744048
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	rmsk_3224389; ENST00000380872.9
External Link	RMBase: m6A_site_90769
mod ID: M6ASITE095340		Click to Show/Hide the Full List
mod site	chr10:4982571-4982572:+		[5]
Sequence	CAAGGACAGTTAGAGTGCAGACCCACCTAACCCTGGACCCA
Motif Score	2.876744048
Cell/Tissue List	Huh7; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380872.9; rmsk_3224389
External Link	RMBase: m6A_site_90770
mod ID: M6ASITE095341		Click to Show/Hide the Full List
mod site	chr10:4982587-4982588:+		[5]
Sequence	GCAGACCCACCTAACCCTGGACCCACTGGTGGTACCCATCC
Motif Score	3.622404762
Cell/Tissue List	Huh7; MSC
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_3224389; ENST00000380872.9
External Link	RMBase: m6A_site_90771
mod ID: M6ASITE095342		Click to Show/Hide the Full List
mod site	chr10:4983051-4983052:+		[7]
Sequence	CTGGTATCCACTGCTGGGAGACTTGTGCTGAGGTGAAGCCT
Motif Score	3.319380952
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000380872.9; rmsk_3224389
External Link	RMBase: m6A_site_90772
mod ID: M6ASITE095343		Click to Show/Hide the Full List
mod site	chr10:4983097-4983098:+		[8]
Sequence	GGATGGCTGGAGGATGAAGAACTGCACGGAGGAGATGGAGG
Motif Score	3.373380952
Cell/Tissue List	HepG2; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_3224390; ENST00000380872.9
External Link	RMBase: m6A_site_90773
mod ID: M6ASITE095344		Click to Show/Hide the Full List
mod site	chr10:4983125-4983126:+		[8]
Sequence	GAGGAGATGGAGGCACCCAGACAGATGCCCCATGGACATCC
Motif Score	2.897386905
Cell/Tissue List	HepG2; A549; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380872.9; rmsk_3224390
External Link	RMBase: m6A_site_90774
mod ID: M6ASITE095345		Click to Show/Hide the Full List
mod site	chr10:4983140-4983141:+		[8]
Sequence	CCCAGACAGATGCCCCATGGACATCCTGAAGCAGAGCTGCC
Motif Score	3.643047619
Cell/Tissue List	HepG2; A549; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_3224390; ENST00000380872.9
External Link	RMBase: m6A_site_90775
mod ID: M6ASITE095346		Click to Show/Hide the Full List
mod site	chr10:4983197-4983198:+		[8]
Sequence	ACATGAGAGCGCAGCCAGGAACAGAAGGACTGGGCAACATT
Motif Score	2.951386905
Cell/Tissue List	HepG2; A549; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_3224390; ENST00000380872.9
External Link	RMBase: m6A_site_90776
mod ID: M6ASITE095347		Click to Show/Hide the Full List
mod site	chr10:4983205-4983206:+		[8]
Sequence	GCGCAGCCAGGAACAGAAGGACTGGGCAACATTCAGGCGGA
Motif Score	4.065041667
Cell/Tissue List	HepG2; A549; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380872.9; rmsk_3224390
External Link	RMBase: m6A_site_90777
mod ID: M6ASITE095348		Click to Show/Hide the Full List
mod site	chr10:4983245-4983246:+		[8]
Sequence	AGCCCAGGCCAATTTTCTAAACATGGAATATGAGTTAAATA
Motif Score	2.20572619
Cell/Tissue List	HepG2; A549; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380872.9; rmsk_3224390
External Link	RMBase: m6A_site_90778

Ref 1	YTHDF1 links hypoxia adaptation and non-small cell lung cancer progression. Nat Commun. 2019 Oct 25;10(1):4892. doi: 10.1038/s41467-019-12801-6.
Ref 2	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 3	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 4	The m(6)A Methyltransferase METTL3 Promotes Translation in Human Cancer Cells. Mol Cell. 2016 May 5;62(3):335-345. doi: 10.1016/j.molcel.2016.03.021. Epub 2016 Apr 21.
Ref 5	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 6	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 7	[Action myoclonias and paranoid alternative psychosis in progressive myoclonic epilepsy (late form of the Lafora type)]. Nervenarzt. 1986 Apr;57(4):233-7.
Ref 8	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map