m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00174)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
AKR1C1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
YTH domain-containing family protein 1 (YTHDF1) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-Aldo-keto reductase family 1 member C1 (AKR1C1) axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Responsed Drug | Cisplatin | Approved | ||
| Pathway Response | Chemical carcinogenesis - reactive oxygen species | hsa05208 | ||
| Cell cycle | hsa04110 | |||
| Cell Process | Biological regulation | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| A549-DDP (Human lung adenocarcinoma is resistant to cisplatin) | ||||
| GLC-82 | Endocervical adenocarcinoma | Homo sapiens | CVCL_3371 | |
| NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 | |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| NCI-H1650 | Minimally invasive lung adenocarcinoma | Homo sapiens | CVCL_1483 | |
| NCI-H838 | Lung adenocarcinoma | Homo sapiens | CVCL_1594 | |
| SPC-A1 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6955 | |
| In-vivo Model | Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 106 p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination. | |||
Lung cancer [ICD-11: 2C25]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-Aldo-keto reductase family 1 member C1 (AKR1C1) axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment. | |||
| Responsed Disease | Non-small-cell lung carcinoma [ICD-11: 2C25.Y] | |||
| Target Regulator | YTH domain-containing family protein 1 (YTHDF1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Cisplatin | Approved | ||
| Pathway Response | Chemical carcinogenesis - reactive oxygen species | hsa05208 | ||
| Cell cycle | hsa04110 | |||
| Cell Process | Biological regulation | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| A549-DDP (Human lung adenocarcinoma is resistant to cisplatin) | ||||
| GLC-82 | Endocervical adenocarcinoma | Homo sapiens | CVCL_3371 | |
| NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 | |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| NCI-H1650 | Minimally invasive lung adenocarcinoma | Homo sapiens | CVCL_1483 | |
| NCI-H838 | Lung adenocarcinoma | Homo sapiens | CVCL_1594 | |
| SPC-A1 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6955 | |
| In-vivo Model | Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 106 p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination. | |||
Cisplatin
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Keap1-Nrf2-Aldo-keto reductase family 1 member C1 (AKR1C1) axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment. | |||
| Target Regulator | YTH domain-containing family protein 1 (YTHDF1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Pathway Response | Chemical carcinogenesis - reactive oxygen species | hsa05208 | ||
| Cell cycle | hsa04110 | |||
| Cell Process | Biological regulation | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| A549-DDP (Human lung adenocarcinoma is resistant to cisplatin) | ||||
| GLC-82 | Endocervical adenocarcinoma | Homo sapiens | CVCL_3371 | |
| NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 | |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| NCI-H1650 | Minimally invasive lung adenocarcinoma | Homo sapiens | CVCL_1483 | |
| NCI-H838 | Lung adenocarcinoma | Homo sapiens | CVCL_1594 | |
| SPC-A1 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6955 | |
| In-vivo Model | Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 106 p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00174)
| In total 23 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE095326 | Click to Show/Hide the Full List | ||
| mod site | chr10:4963353-4963354:+ | [2] | |
| Sequence | TGCCATTGGTTAACCAGCAGACAGTGTGCTCAGGGGCGTTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000477661.1 | ||
| External Link | RMBase: m6A_site_90754 | ||
| mod ID: M6ASITE095327 | Click to Show/Hide the Full List | ||
| mod site | chr10:4963416-4963417:+ | [2] | |
| Sequence | TGTGAGGGAGGAAGAAAGAAACATTTGCCAGCCAGGCTAGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | A549; Huh7; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9; ENST00000477661.1 | ||
| External Link | RMBase: m6A_site_90755 | ||
| mod ID: M6ASITE095328 | Click to Show/Hide the Full List | ||
| mod site | chr10:4963438-4963439:+ | [3] | |
| Sequence | ATTTGCCAGCCAGGCTAGTGACAGAAATGGATTCGAAATAT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000477661.1; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90756 | ||
| mod ID: M6ASITE095329 | Click to Show/Hide the Full List | ||
| mod site | chr10:4963838-4963839:+ | [4] | |
| Sequence | CTGTTTCTTTGTATAGTCGAACAGATATTTACTTCTTCCAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | A549; Huh7; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000477661.1; ENST00000380859.1; ENST00000380872.9; ENST00000442997.5 | ||
| External Link | RMBase: m6A_site_90757 | ||
| mod ID: M6ASITE095330 | Click to Show/Hide the Full List | ||
| mod site | chr10:4981286-4981287:+ | [5] | |
| Sequence | ATTGTTAGAATAGTAAATGAACATCATATGTTGTAATATAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90760 | ||
| mod ID: M6ASITE095331 | Click to Show/Hide the Full List | ||
| mod site | chr10:4981351-4981352:+ | [5] | |
| Sequence | TACAAGAAATAATTTTAAAAACTACTCAAAGAAATCAGAGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | rmsk_3224386; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90761 | ||
| mod ID: M6ASITE095332 | Click to Show/Hide the Full List | ||
| mod site | chr10:4981389-4981390:+ | [5] | |
| Sequence | AGATATCACAAAATGACAAAACAAGTACAGGGGCAGCAAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9; rmsk_3224386 | ||
| External Link | RMBase: m6A_site_90762 | ||
| mod ID: M6ASITE095333 | Click to Show/Hide the Full List | ||
| mod site | chr10:4981444-4981445:+ | [5] | |
| Sequence | ACTATGAGATCTCATCAAGAACTAAGAAAATGGAGAAAAGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90763 | ||
| mod ID: M6ASITE095334 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982374-4982375:+ | [6] | |
| Sequence | CGCCCCACCCCCCTCCCTGGACAGCCCAGCTACAATTGTCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90764 | ||
| mod ID: M6ASITE095335 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982399-4982400:+ | [6] | |
| Sequence | CCAGCTACAATTGTCTGAGAACTCACTGCAAGCTGTAAGCG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90765 | ||
| mod ID: M6ASITE095336 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982448-4982449:+ | [2] | |
| Sequence | CTTCCCACTCCCTTTTTTGAACTCTTCTGTGCAGCAGAGGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90766 | ||
| mod ID: M6ASITE095337 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982475-4982476:+ | [2] | |
| Sequence | TGTGCAGCAGAGGCAATTAAACTCTCCTCTGGAACATTACC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | A549; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9; rmsk_3224389 | ||
| External Link | RMBase: m6A_site_90767 | ||
| mod ID: M6ASITE095338 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982488-4982489:+ | [2] | |
| Sequence | CAATTAAACTCTCCTCTGGAACATTACCCCAGCAGCCTGAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | A549; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | rmsk_3224389; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90768 | ||
| mod ID: M6ASITE095339 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982510-4982511:+ | [2] | |
| Sequence | ATTACCCCAGCAGCCTGAGAACCACCCCTTGGCGCTCACAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | rmsk_3224389; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90769 | ||
| mod ID: M6ASITE095340 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982571-4982572:+ | [5] | |
| Sequence | CAAGGACAGTTAGAGTGCAGACCCACCTAACCCTGGACCCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7; MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9; rmsk_3224389 | ||
| External Link | RMBase: m6A_site_90770 | ||
| mod ID: M6ASITE095341 | Click to Show/Hide the Full List | ||
| mod site | chr10:4982587-4982588:+ | [5] | |
| Sequence | GCAGACCCACCTAACCCTGGACCCACTGGTGGTACCCATCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7; MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | rmsk_3224389; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90771 | ||
| mod ID: M6ASITE095342 | Click to Show/Hide the Full List | ||
| mod site | chr10:4983051-4983052:+ | [7] | |
| Sequence | CTGGTATCCACTGCTGGGAGACTTGTGCTGAGGTGAAGCCT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000380872.9; rmsk_3224389 | ||
| External Link | RMBase: m6A_site_90772 | ||
| mod ID: M6ASITE095343 | Click to Show/Hide the Full List | ||
| mod site | chr10:4983097-4983098:+ | [8] | |
| Sequence | GGATGGCTGGAGGATGAAGAACTGCACGGAGGAGATGGAGG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; A549 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | rmsk_3224390; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90773 | ||
| mod ID: M6ASITE095344 | Click to Show/Hide the Full List | ||
| mod site | chr10:4983125-4983126:+ | [8] | |
| Sequence | GAGGAGATGGAGGCACCCAGACAGATGCCCCATGGACATCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HepG2; A549; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9; rmsk_3224390 | ||
| External Link | RMBase: m6A_site_90774 | ||
| mod ID: M6ASITE095345 | Click to Show/Hide the Full List | ||
| mod site | chr10:4983140-4983141:+ | [8] | |
| Sequence | CCCAGACAGATGCCCCATGGACATCCTGAAGCAGAGCTGCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2; A549; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | rmsk_3224390; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90775 | ||
| mod ID: M6ASITE095346 | Click to Show/Hide the Full List | ||
| mod site | chr10:4983197-4983198:+ | [8] | |
| Sequence | ACATGAGAGCGCAGCCAGGAACAGAAGGACTGGGCAACATT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HepG2; A549; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | rmsk_3224390; ENST00000380872.9 | ||
| External Link | RMBase: m6A_site_90776 | ||
| mod ID: M6ASITE095347 | Click to Show/Hide the Full List | ||
| mod site | chr10:4983205-4983206:+ | [8] | |
| Sequence | GCGCAGCCAGGAACAGAAGGACTGGGCAACATTCAGGCGGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HepG2; A549; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9; rmsk_3224390 | ||
| External Link | RMBase: m6A_site_90777 | ||
| mod ID: M6ASITE095348 | Click to Show/Hide the Full List | ||
| mod site | chr10:4983245-4983246:+ | [8] | |
| Sequence | AGCCCAGGCCAATTTTCTAAACATGGAATATGAGTTAAATA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HepG2; A549; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380872.9; rmsk_3224390 | ||
| External Link | RMBase: m6A_site_90778 | ||
References