m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00160)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PGD
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
YTH domain-containing family protein 2 (YTHDF2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | YTHDF2 directly binds to the m6A modification site of 6-phosphogluconate dehydrogenase, decarboxylating (6PGD/PGD) three prime untranslated region (3'-UTR) to promote 6PGD mRNA translation in lung cancer cells. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Lung cancer | ICD-11: 2C25 | ||
| Pathway Response | Pentose phosphate pathway | hsa00030 | ||
| Cell Process | Cell growth | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
Lung cancer [ICD-11: 2C25]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | YTHDF2 directly binds to the m6A modification site of 6-phosphogluconate dehydrogenase, decarboxylating (6PGD/PGD) three prime untranslated region (3'-UTR) to promote 6PGD mRNA translation in lung cancer cells. | |||
| Responsed Disease | Lung cancer [ICD-11: 2C25] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Pentose phosphate pathway | hsa00030 | ||
| Cell Process | Cell growth | |||
| In-vitro Model | A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 |
| NCI-H1299 | Lung large cell carcinoma | Homo sapiens | CVCL_0060 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT02136 | ||
| Epigenetic Regulator | DNA (cytosine-5)-methyltransferase 1 (DNMT1) | |
| Regulated Target | RNA demethylase ALKBH5 (ALKBH5) | |
| Crosstalk relationship | DNA modification → m6A | |
| Disease | Lung cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00160)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: AC4SITE000106 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413179-10413180:+ | [2] | |
| Sequence | GCCAAAGATCAGGGACAGCGCGGGGCAGAAGGGCACAGGGA | ||
| Cell/Tissue List | H1 | ||
| Seq Type List | ac4C-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000483936.5; ENST00000460189.1; ENST00000493288.1 | ||
| External Link | RMBase: ac4C_site_16 | ||
| mod ID: AC4SITE000125 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420017-10420018:+ | [3] | |
| Sequence | GCAGTGGCTTCCGCGTGCCCCGTGTGCTGGTGCGGTTCCCA | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | ac4C-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: ac4C_site_17 | ||
Adenosine-to-Inosine editing (A-to-I)
| In total 3 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE001949 | Click to Show/Hide the Full List | ||
| mod site | chr1:10402843-10402844:+ | [4] | |
| Sequence | ACAAAAAAAATTTTAAAACTAGCTGGGCATTGTGGTTCAAG | ||
| Transcript ID List | ENST00000465632.5; ENST00000483936.5; rmsk_19690; ENST00000270776.13; ENST00000477958.5; ENST00000460189.1; ENST00000491493.5 | ||
| External Link | RMBase: RNA-editing_site_1214 | ||
| mod ID: A2ISITE001988 | Click to Show/Hide the Full List | ||
| mod site | chr1:10404704-10404705:+ | [4] | |
| Sequence | AGACAGGGTTTCACCATGTTACCTTGGGTGGTCTCGAACTC | ||
| Transcript ID List | ENST00000465632.5; ENST00000460189.1; ENST00000483936.5; ENST00000491493.5; ENST00000270776.13 | ||
| External Link | RMBase: RNA-editing_site_1215 | ||
| mod ID: A2ISITE001989 | Click to Show/Hide the Full List | ||
| mod site | chr1:10418627-10418628:+ | [4] | |
| Sequence | CTACTAAAAATACAAAAATTAGCCGGTTGTAGTGGTGCGTG | ||
| Transcript ID List | ENST00000498356.1; ENST00000270776.13; rmsk_19725 | ||
| External Link | RMBase: RNA-editing_site_1216 | ||
5-methylcytidine (m5C)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE005219 | Click to Show/Hide the Full List | ||
| mod site | chr1:10416978-10416979:+ | [5] | |
| Sequence | GTTTCCTCTTCCCGATCTCCCCATGTAGGAGAAGCTGTCTT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000493288.1; ENST00000270776.13; ENST00000483936.5; ENST00000498356.1 | ||
| External Link | RMBase: m5C_site_790 | ||
N6-methyladenosine (m6A)
| In total 57 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE067169 | Click to Show/Hide the Full List | ||
| mod site | chr1:10398731-10398732:+ | [6] | |
| Sequence | GGCGTCCGAGTGCCTGGTAAACTGTAAAGCGCGGTCCTGCG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; A549; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000491493.5 | ||
| External Link | RMBase: m6A_site_6485 | ||
| mod ID: M6ASITE067205 | Click to Show/Hide the Full List | ||
| mod site | chr1:10399530-10399531:+ | [6] | |
| Sequence | AGGCGCGGAGGAAAGTGCAGACTCCCAGTCACGGCCAAATG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; A549; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000491493.5; ENST00000477958.5; ENST00000465632.5; ENST00000487775.1; ENST00000483936.5; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6486 | ||
| mod ID: M6ASITE067257 | Click to Show/Hide the Full List | ||
| mod site | chr1:10399558-10399559:+ | [6] | |
| Sequence | TCACGGCCAAATGTGGAAGGACCGGACCCCTGGGTTGCAGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000491493.5; ENST00000483936.5; ENST00000465632.5; ENST00000270776.13; ENST00000477958.5; ENST00000487775.1 | ||
| External Link | RMBase: m6A_site_6487 | ||
| mod ID: M6ASITE067258 | Click to Show/Hide the Full List | ||
| mod site | chr1:10399563-10399564:+ | [6] | |
| Sequence | GCCAAATGTGGAAGGACCGGACCCCTGGGTTGCAGCGCGTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000477958.5; ENST00000491493.5; ENST00000270776.13; ENST00000487775.1; ENST00000465632.5; ENST00000483936.5 | ||
| External Link | RMBase: m6A_site_6488 | ||
| mod ID: M6ASITE067259 | Click to Show/Hide the Full List | ||
| mod site | chr1:10399633-10399634:+ | [7] | |
| Sequence | TTTCTGCCTCTCTAGAGCTGACATCGCGCTGATCGGATTGG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000460189.1; ENST00000487775.1; ENST00000491493.5; ENST00000270776.13; ENST00000483936.5; ENST00000477958.5; ENST00000465632.5 | ||
| External Link | RMBase: m6A_site_6489 | ||
| mod ID: M6ASITE067260 | Click to Show/Hide the Full List | ||
| mod site | chr1:10399669-10399670:+ | [8] | |
| Sequence | ATTGGCCGTCATGGGCCAGAACTTAATTCTGAACATGAATG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000483936.5; ENST00000491493.5; ENST00000465632.5; ENST00000460189.1; ENST00000477958.5; ENST00000487775.1 | ||
| External Link | RMBase: m6A_site_6490 | ||
| mod ID: M6ASITE067307 | Click to Show/Hide the Full List | ||
| mod site | chr1:10399681-10399682:+ | [7] | |
| Sequence | GGGCCAGAACTTAATTCTGAACATGAATGACCACGGCTTTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T; A549; TIME | ||
| Seq Type List | MAZTER-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000487775.1; ENST00000477958.5; ENST00000491493.5; ENST00000270776.13; ENST00000465632.5; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6491 | ||
| mod ID: M6ASITE067310 | Click to Show/Hide the Full List | ||
| mod site | chr1:10400410-10400411:+ | [9] | |
| Sequence | AGGTCTGTGCTTTTAATAGGACTGTCTCCAAAGTTGATGAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000465632.5; ENST00000491493.5; ENST00000483936.5; ENST00000270776.13; ENST00000477958.5; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6492 | ||
| mod ID: M6ASITE067346 | Click to Show/Hide the Full List | ||
| mod site | chr1:10403092-10403093:+ | [7] | |
| Sequence | ACCATTGTTGGATACTGGTGACATCATCATTGACGGAGGAA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000477958.5; ENST00000460189.1; ENST00000465632.5; ENST00000483936.5; ENST00000270776.13; ENST00000491493.5 | ||
| External Link | RMBase: m6A_site_6493 | ||
| mod ID: M6ASITE067373 | Click to Show/Hide the Full List | ||
| mod site | chr1:10403128-10403129:+ | [10] | |
| Sequence | AGGAAATTCTGAATATAGGGACACCACAGTAAGTGTTCTTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | MT4; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000491493.5; ENST00000477958.5; ENST00000460189.1; ENST00000483936.5; ENST00000270776.13; ENST00000465632.5 | ||
| External Link | RMBase: m6A_site_6494 | ||
| mod ID: M6ASITE067374 | Click to Show/Hide the Full List | ||
| mod site | chr1:10403133-10403134:+ | [7] | |
| Sequence | ATTCTGAATATAGGGACACCACAGTAAGTGTTCTTCAGTCC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000270776.13; ENST00000465632.5; ENST00000477958.5; ENST00000491493.5; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6495 | ||
| mod ID: M6ASITE067375 | Click to Show/Hide the Full List | ||
| mod site | chr1:10404173-10404174:+ | [10] | |
| Sequence | CCTTCAGAGACGGTGCCGAGACCTCAAGGCCAAGGGAATTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | MT4; A549; Huh7 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000477958.5; ENST00000483936.5; ENST00000465632.5; ENST00000491493.5; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6496 | ||
| mod ID: M6ASITE067376 | Click to Show/Hide the Full List | ||
| mod site | chr1:10404266-10404267:+ | [7] | |
| Sequence | ATCGCTCATGCCAGGAGGGAACAAAGAAGCGTGGTGAGTGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T; HepG2; MT4; A549; Huh7; endometrial | ||
| Seq Type List | MAZTER-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000491493.5; ENST00000477958.5; ENST00000465632.5; ENST00000483936.5; ENST00000460189.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6497 | ||
| mod ID: M6ASITE067417 | Click to Show/Hide the Full List | ||
| mod site | chr1:10408075-10408076:+ | [7] | |
| Sequence | TGTTTCTTTACACAGGCCCCACATCAAGACCATCTTCCAAG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000491493.5; ENST00000460189.1; ENST00000270776.13; ENST00000465632.5; ENST00000483936.5 | ||
| External Link | RMBase: m6A_site_6498 | ||
| mod ID: M6ASITE067457 | Click to Show/Hide the Full List | ||
| mod site | chr1:10408083-10408084:+ | [11] | |
| Sequence | TACACAGGCCCCACATCAAGACCATCTTCCAAGGCATTGCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; MT4; A549; Huh7; peripheral-blood; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000491493.5; ENST00000465632.5; ENST00000460189.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6499 | ||
| mod ID: M6ASITE067480 | Click to Show/Hide the Full List | ||
| mod site | chr1:10408116-10408117:+ | [11] | |
| Sequence | GCATTGCTGCAAAAGTGGGAACTGGAGAACCCTGCTGTGAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; MT4; A549; Huh7; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000465632.5; ENST00000483936.5; ENST00000491493.5; ENST00000270776.13; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6500 | ||
| mod ID: M6ASITE067581 | Click to Show/Hide the Full List | ||
| mod site | chr1:10408124-10408125:+ | [11] | |
| Sequence | GCAAAAGTGGGAACTGGAGAACCCTGCTGTGACTGGGCAAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; MT4; A549; Huh7; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000270776.13; ENST00000460189.1; ENST00000491493.5; ENST00000465632.5 | ||
| External Link | RMBase: m6A_site_6501 | ||
| mod ID: M6ASITE067658 | Click to Show/Hide the Full List | ||
| mod site | chr1:10411457-10411458:+ | [7] | |
| Sequence | CCACTTCGTGAAGATGGTGCACAACGGGATAGAGTATGGGG | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000491493.5; ENST00000460189.1; ENST00000483936.5 | ||
| External Link | RMBase: m6A_site_6502 | ||
| mod ID: M6ASITE067659 | Click to Show/Hide the Full List | ||
| mod site | chr1:10411478-10411479:+ | [7] | |
| Sequence | CAACGGGATAGAGTATGGGGACATGCAGCTGATCTGTGAGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T; HepG2; MT4; A549; Huh7; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | MAZTER-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000491493.5; ENST00000270776.13; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6503 | ||
| mod ID: M6ASITE067660 | Click to Show/Hide the Full List | ||
| mod site | chr1:10411538-10411539:+ | [9] | |
| Sequence | CGTGCTGGGCATGGCGCAGGACGAGATGGCCCAGGTGAGGC | ||
| Motif Score | 3.616982143 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000491493.5; ENST00000483936.5; ENST00000460189.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6504 | ||
| mod ID: M6ASITE067661 | Click to Show/Hide the Full List | ||
| mod site | chr1:10412836-10412837:+ | [10] | |
| Sequence | GAGCCCTTGCCTCTGAGGAGACAACACTTCTGGTGGCCAGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MT4; A549; Huh7; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000483936.5; ENST00000493288.1; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6505 | ||
| mod ID: M6ASITE067662 | Click to Show/Hide the Full List | ||
| mod site | chr1:10412880-10412881:+ | [10] | |
| Sequence | TCAGTATAACCAGGTTCAGAACAAACACAACTGACTCTGGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | MT4; A549; Huh7; peripheral-blood; endometrial; NB4 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000493288.1; ENST00000483936.5; ENST00000270776.13; ENST00000460189.1 | ||
| External Link | RMBase: m6A_site_6506 | ||
| mod ID: M6ASITE067663 | Click to Show/Hide the Full List | ||
| mod site | chr1:10412911-10412912:+ | [10] | |
| Sequence | TGACTCTGGGTTAGCATAAAACTCAACCAGCAGGAGCAGAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | MT4; A549; Huh7 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000493288.1; ENST00000270776.13; ENST00000460189.1; ENST00000483936.5 | ||
| External Link | RMBase: m6A_site_6507 | ||
| mod ID: M6ASITE067664 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413082-10413083:+ | [12] | |
| Sequence | CCTTTGAGGATTGGAATAAGACAGAGCTAGACTCATTCCTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000460189.1; ENST00000493288.1; ENST00000483936.5; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6508 | ||
| mod ID: M6ASITE067665 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413092-10413093:+ | [12] | |
| Sequence | TTGGAATAAGACAGAGCTAGACTCATTCCTGATTGAAATCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | CD34; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000493288.1; ENST00000460189.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6509 | ||
| mod ID: M6ASITE067666 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413112-10413113:+ | [13] | |
| Sequence | ACTCATTCCTGATTGAAATCACAGCCAATATTCTCAAGTTC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000460189.1; ENST00000483936.5; ENST00000493288.1 | ||
| External Link | RMBase: m6A_site_6510 | ||
| mod ID: M6ASITE067667 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413137-10413138:+ | [12] | |
| Sequence | CAATATTCTCAAGTTCCAAGACACCGATGGCAAACACCTGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000270776.13; ENST00000460189.1; ENST00000493288.1 | ||
| External Link | RMBase: m6A_site_6511 | ||
| mod ID: M6ASITE067751 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413150-10413151:+ | [12] | |
| Sequence | TTCCAAGACACCGATGGCAAACACCTGCTGCCAAAGATCAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | CD34; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000460189.1; ENST00000493288.1; ENST00000270776.13; ENST00000483936.5 | ||
| External Link | RMBase: m6A_site_6512 | ||
| mod ID: M6ASITE067782 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413173-10413174:+ | [12] | |
| Sequence | CCTGCTGCCAAAGATCAGGGACAGCGCGGGGCAGAAGGGCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | CD34; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483936.5; ENST00000493288.1; ENST00000460189.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6513 | ||
| mod ID: M6ASITE067783 | Click to Show/Hide the Full List | ||
| mod site | chr1:10413205-10413206:+ | [12] | |
| Sequence | AGAAGGGCACAGGGAAGTGGACCGCCATCTCCGCCCTGGAA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | CD34; HepG2; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000460189.1; ENST00000483936.5; ENST00000270776.13; ENST00000493288.1 | ||
| External Link | RMBase: m6A_site_6514 | ||
| mod ID: M6ASITE067784 | Click to Show/Hide the Full List | ||
| mod site | chr1:10415378-10415379:+ | [12] | |
| Sequence | GAGCAATTTATTCATCACGGACTCAAGTATATGTGTAAGTA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000493288.1; ENST00000270776.13; ENST00000498356.1; ENST00000483936.5 | ||
| External Link | RMBase: m6A_site_6515 | ||
| mod ID: M6ASITE067785 | Click to Show/Hide the Full List | ||
| mod site | chr1:10417106-10417107:+ | [7] | |
| Sequence | TAAGAAATCATTCCTGGAGGACATTCGGAAGGTGGGACACA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000498356.1; ENST00000483936.5 | ||
| External Link | RMBase: m6A_site_6516 | ||
| mod ID: M6ASITE067864 | Click to Show/Hide the Full List | ||
| mod site | chr1:10418917-10418918:+ | [12] | |
| Sequence | CTTTAAGTCAGCTGTTGAAAACTGCCAGGTATGTAGCCTAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000496718.1; ENST00000498356.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6517 | ||
| mod ID: M6ASITE067958 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419508-10419509:+ | [12] | |
| Sequence | TCCTTCTATGACGGGTACAGACATGAGATGCTTCCAGCCAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; hESC-HEK293T; HepG2; HeLa | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000498356.1; ENST00000496718.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6518 | ||
| mod ID: M6ASITE067970 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419595-10419596:+ | [12] | |
| Sequence | CTCGGGGGCGTGCGCCATGGACTGTCCTGACCAACCTACTC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | CD34; HepG2; HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000496718.1; ENST00000498356.1 | ||
| External Link | RMBase: m6A_site_6519 | ||
| mod ID: M6ASITE067971 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419654-10419655:+ | [7] | |
| Sequence | GCGGGATTACTTCGGGGCTCACACCTATGAACTCTTGGCCA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000498356.1; ENST00000496718.1 | ||
| External Link | RMBase: m6A_site_6520 | ||
| mod ID: M6ASITE067972 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419664-10419665:+ | [12] | |
| Sequence | TTCGGGGCTCACACCTATGAACTCTTGGCCAAACCAGGGCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | CD34; HEK293T; HepG2; HeLa; A549; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq; DART-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000498356.1; ENST00000496718.1 | ||
| External Link | RMBase: m6A_site_6521 | ||
| mod ID: M6ASITE067973 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419676-10419677:+ | [12] | |
| Sequence | ACCTATGAACTCTTGGCCAAACCAGGGCAGTTTATCCACAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | CD34; HEK293T; HepG2; HeLa; A549; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000498356.1; ENST00000496718.1 | ||
| External Link | RMBase: m6A_site_6522 | ||
| mod ID: M6ASITE067981 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419693-10419694:+ | [13] | |
| Sequence | CAAACCAGGGCAGTTTATCCACACCAACTGGACAGGCCATG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | HEK293; kidney; liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000496718.1; ENST00000498356.1 | ||
| External Link | RMBase: m6A_site_6523 | ||
| mod ID: M6ASITE067992 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419704-10419705:+ | [12] | |
| Sequence | AGTTTATCCACACCAACTGGACAGGCCATGGTGGCACCGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | CD34; HEK293T; hESC-HEK293T; HepG2; HeLa; hESCs; A549; Huh7; HEK293A-TOA; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000498356.1; ENST00000496718.1 | ||
| External Link | RMBase: m6A_site_6524 | ||
| mod ID: M6ASITE068037 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419738-10419739:+ | [7] | |
| Sequence | CACCGTGTCATCCTCGTCATACAATGCCTGATCATGCTGCT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000498356.1; ENST00000496718.1 | ||
| External Link | RMBase: m6A_site_6525 | ||
| mod ID: M6ASITE068122 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419784-10419785:+ | [12] | |
| Sequence | CACCCTCCACGATTCCACAGACCAGGACATTCCATGTGCCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | CD34; HEK293T; HepG2; HeLa; hESCs; A549; Huh7; HEK293A-TOA; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000496718.1; ENST00000498356.1; ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6526 | ||
| mod ID: M6ASITE068177 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419790-10419791:+ | [12] | |
| Sequence | CCACGATTCCACAGACCAGGACATTCCATGTGCCTCATGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | CD34; HEK293T; hESC-HEK293T; HepG2; HeLa; hESCs; A549; Huh7; HEK293A-TOA; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13; ENST00000498356.1; ENST00000496718.1 | ||
| External Link | RMBase: m6A_site_6527 | ||
| mod ID: M6ASITE068266 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419869-10419870:+ | [12] | |
| Sequence | TTTTAAAAGTGTTGTAAGAGACTCCTGAGGAAGACACACAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | CD34; HEK293T; HepG2; HeLa; hESCs; A549; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq; DART-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6528 | ||
| mod ID: M6ASITE068283 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419882-10419883:+ | [12] | |
| Sequence | GTAAGAGACTCCTGAGGAAGACACACAGTTTATTTGTAAAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; HEK293T; hESC-HEK293T; HepG2; HeLa; hESCs; A549; MSC; TIME; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6529 | ||
| mod ID: M6ASITE068284 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419947-10419948:+ | [9] | |
| Sequence | CTCTGCCCTTGCCTCTTGGGACTGACCAGGAGCTGCTCATG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEK293T; HepG2; HeLa; A549; TIME | ||
| Seq Type List | DART-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6530 | ||
| mod ID: M6ASITE068285 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419983-10419984:+ | [11] | |
| Sequence | TCATGTGCGTGAGAGTGGGAACCATCTCCTTGCGGCAGTGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; HeLa; A549; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6531 | ||
| mod ID: M6ASITE068286 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420046-10420047:+ | [13] | |
| Sequence | GTGCGGTTCCCATCACGCAGACAGGAAGGGTGTTTGCGCAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293; HeLa; A549 | ||
| Seq Type List | m6A-REF-seq; m6A-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6532 | ||
| mod ID: M6ASITE068287 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420081-10420082:+ | [8] | |
| Sequence | GCGCACTCTGATCAACTGGAACCTCTGTATCATGCGGCTGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6533 | ||
| mod ID: M6ASITE068288 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420118-10420119:+ | [9] | |
| Sequence | CTGAATTCCCTTTTTCCTTTACTCAATAAAAGCTACATCAG | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6534 | ||
| mod ID: M6ASITE068289 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420132-10420133:+ | [9] | |
| Sequence | TCCTTTACTCAATAAAAGCTACATCAGACTGATGCTCTTTC | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6535 | ||
| mod ID: M6ASITE068290 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420139-10420140:+ | [9] | |
| Sequence | CTCAATAAAAGCTACATCAGACTGATGCTCTTTCTCCAGAT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6536 | ||
| mod ID: M6ASITE068291 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420230-10420231:+ | [6] | |
| Sequence | ATTTTTCTTTAAAAAAAAAGACTAGAATAACACAAGAAACC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6537 | ||
| mod ID: M6ASITE068292 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420239-10420240:+ | [9] | |
| Sequence | TAAAAAAAAAGACTAGAATAACACAAGAAACCACATTTAGG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6538 | ||
| mod ID: M6ASITE068293 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420248-10420249:+ | [6] | |
| Sequence | AGACTAGAATAACACAAGAAACCACATTTAGGATTATGCTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: m6A_site_6539 | ||
| mod ID: M6ASITE068294 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420294-10420295:+ | [6] | |
| Sequence | AGAGGAGGCAGGCAGGGAGGACACACCAGGGGCTTTAATAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; MT4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000270776.13; rmsk_19727 | ||
| External Link | RMBase: m6A_site_6540 | ||
| mod ID: M6ASITE068310 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420364-10420365:+ | [9] | |
| Sequence | CAATGGGTACATGGACGTTCACTGTAACGTGCTTTTTCTTT | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000270776.13; rmsk_19727 | ||
| External Link | RMBase: m6A_site_6541 | ||
2'-O-Methylation (2'-O-Me)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000153 | Click to Show/Hide the Full List | ||
| mod site | chr1:10419960-10419961:+ | [14] | |
| Sequence | TCTTGGGACTGACCAGGAGCTGCTCATGTGCGTGAGAGTGG | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: Nm_site_24 | ||
| mod ID: 2OMSITE000160 | Click to Show/Hide the Full List | ||
| mod site | chr1:10420077-10420078:+ | [14] | |
| Sequence | GTTTGCGCACTCTGATCAACTGGAACCTCTGTATCATGCGG | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000270776.13 | ||
| External Link | RMBase: Nm_site_25 | ||
References