m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00104)
Target Name ACBD3 antisense RNA 1 (ACBD3-AS1)
Synonyms
ACBD3-AS1; RP11-275I14.4
    Click to Show/Hide
Gene Name ACBD3-AS1
Chromosomal Location 1q42.12
Family Antisense RNAs
Gene ID 107985353
HGNC ID
HGNC:40701
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ACBD3-AS1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Disease
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary m6A lncRNA is closely related to the occurrence and progression of gastric cancer. ACBD3 antisense RNA 1 (ACBD3-AS1) was overexpressed in tumor tissue. Naive B cell, Plasma cells, resting CD4 memory T cell were highly infiltrated tissues in cluster 2, while Macrophages M2, resting Mast cells, Monocytes, regulates T cells were lowly in cluster 1.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Pathway Response T cell receptor signaling pathway hsa04660
Cell Process Immune
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00104)
ACBD3 antisense RNA 1 (ACBD3-AS1)
N6-methyladenosine (m6A)
In total 8 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087895 Click to Show/Hide the Full List
mod site chr1:226148063-226148064:+ [1]
Sequence GCCACTATCAGGAATTTAAAACAAGGTAAGTTTGAGAAATT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; hNPCs; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000440540.1; rmsk_401262
External Link RMBase: m6A_site_81954
mod ID: M6ASITE087896 Click to Show/Hide the Full List
mod site chr1:226154623-226154624:+ [1]
Sequence TTTGGAATTATGACATCTGGACAAACACATATGCAAAACCT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; hNPCs; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000440540.1
External Link RMBase: m6A_site_81963
mod ID: M6ASITE087897 Click to Show/Hide the Full List
mod site chr1:226154627-226154628:+ [1]
Sequence GAATTATGACATCTGGACAAACACATATGCAAAACCTACCT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; hESCs; HEK293T; fibroblasts; A549; Jurkat
Seq Type List m6A-seq
Transcript ID List ENST00000440540.1
External Link RMBase: m6A_site_81964
mod ID: M6ASITE087898 Click to Show/Hide the Full List
mod site chr1:226154640-226154641:+ [1]
Sequence TGGACAAACACATATGCAAAACCTACCTTTTGGTCCATTCT
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34; HEK293T; hNPCs; hESCs; fibroblasts; A549; MM6; Jurkat
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000440540.1
External Link RMBase: m6A_site_81965
mod ID: M6ASITE087899 Click to Show/Hide the Full List
mod site chr1:226154793-226154794:+ [1]
Sequence TGATGATGTAGGCAAGGAAGACCCAGCCACTACTACTTCCT
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HEK293T; hESCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000440540.1
External Link RMBase: m6A_site_81972
mod ID: M6ASITE087900 Click to Show/Hide the Full List
mod site chr1:226154839-226154840:+ [1]
Sequence TTCTGTAATGCTGCCTACAAACCAAGAGAAAGTGAAGACAC
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000440540.1
External Link RMBase: m6A_site_81974
mod ID: M6ASITE087901 Click to Show/Hide the Full List
mod site chr1:226154856-226154857:+ [1]
Sequence CAAACCAAGAGAAAGTGAAGACACACTGACCAGGAAGGCTA
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000440540.1
External Link RMBase: m6A_site_81975
mod ID: M6ASITE087902 Click to Show/Hide the Full List
mod site chr1:226154886-226154887:+ [1]
Sequence CAGGAAGGCTAGCAAATAAGACATCTGCCCTGGAGTACATC
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000440540.1
External Link RMBase: m6A_site_81976