m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00103)

Target Name	FEZF1 antisense RNA 1 (FEZF1-AS1)
Synonyms	FEZF1-AS1; FEZF1 antisense RNA 1 (non-protein coding) Click to Show/Hide
Gene Name	FEZF1-AS1
Chromosomal Location	7q31.32
Family	Antisense RNAs
Gene ID	154860
HGNC ID	HGNC:41001

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

FEZF1-AS1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Disease

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	FEZF1 antisense RNA 1 (FEZF1-AS1) was upregulated and acted as an oncogene in non-small cell lung cancer by regulating the ITGA11/miR-516b-5p axis, suggesting that FEZF1-AS1 is a potential prognostic biomarker and therapeutic target for NSCLC.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Pathway Response	Cell cycle	hsa04110
Cell Process	Cell proliferation and migration
In-vitro Model	()
	()
	()
	()
	()
	()
	()

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00103)

FEZF1 antisense RNA 1 (FEZF1-AS1)

N6-methyladenosine (m6A)

In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE082071		Click to Show/Hide the Full List
mod site	chr7:122303773-122303774:+		[1]
Sequence	ATGCTGCAGCTGAGCCTGGGACAGGTCTTTGAAAGCTACTC
Motif Score	3.643047619
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774460
mod ID: M6ASITE082072		Click to Show/Hide the Full List
mod site	chr7:122303820-122303821:+		[1]
Sequence	GGTATTTCTCCACCGCCGGGACCACCAGTTTATTCCTTTCG
Motif Score	3.622404762
Cell/Tissue List	hNPCs; hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774462
mod ID: M6ASITE082073		Click to Show/Hide the Full List
mod site	chr7:122303876-122303877:+		[1]
Sequence	GGCTGCGGGTGCAAAGGGGAACTGAGGAAGTAGGAGGCCAC
Motif Score	3.373380952
Cell/Tissue List	hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774464
mod ID: M6ASITE082074		Click to Show/Hide the Full List
mod site	chr7:122305549-122305550:+		[1]
Sequence	AGCAACCTTGACTCGATCGGACCCCACCCAGGATACACACA
Motif Score	3.622404762
Cell/Tissue List	hNPCs; hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000437317.1; ENST00000428449.5
External Link	RMBase: m6A_site_774469
mod ID: M6ASITE082075		Click to Show/Hide the Full List
mod site	chr7:122305795-122305796:+		[1]
Sequence	TGTCTGTGCGCATCAAGGAGACTTGCCGGCGCCAGAGTTGT
Motif Score	3.319380952
Cell/Tissue List	hNPCs; hESCs; GSC-11; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000437317.1; ENST00000428449.5
External Link	RMBase: m6A_site_774470
mod ID: M6ASITE082076		Click to Show/Hide the Full List
mod site	chr7:122305858-122305859:+		[1]
Sequence	CCCAAAGAGCGCGCGTAGAGACCATTTCCCCTGCAACGCCC
Motif Score	2.876744048
Cell/Tissue List	hNPCs; hESCs; GSC-11; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774471
mod ID: M6ASITE082077		Click to Show/Hide the Full List
mod site	chr7:122305888-122305889:+		[2]
Sequence	CTGCAACGCCCCCCAGCCGAACACCCGCCGGGTGTGGCACC
Motif Score	2.951386905
Cell/Tissue List	H1A; hNPCs; hESCs; GSC-11; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774472
mod ID: M6ASITE082078		Click to Show/Hide the Full List
mod site	chr7:122305918-122305919:+		[2]
Sequence	GGTGTGGCACCTCGGCCGAAACTCCTGGGGCGGCGCGGTGG
Motif Score	2.627720238
Cell/Tissue List	H1A; hNPCs; GSC-11; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774473
mod ID: M6ASITE082079		Click to Show/Hide the Full List
mod site	chr7:122306094-122306095:+		[3]
Sequence	CGGCGATCACGCAGAGCTGAACCCCGCAGCTAGGCGCGCAG
Motif Score	2.930744048
Cell/Tissue List	GSC-11; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774474
mod ID: M6ASITE082080		Click to Show/Hide the Full List
mod site	chr7:122306138-122306139:+		[3]
Sequence	GGGCTGCACAGAGTTTGAAGACACGGCAGCTGTAAGCTGGC
Motif Score	2.897386905
Cell/Tissue List	GSC-11; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774475
mod ID: M6ASITE082081		Click to Show/Hide the Full List
mod site	chr7:122306213-122306214:+		[3]
Sequence	CAAAGGGCGGTGGGGCCTGGACCCTGAAGTGAGTGGCCGAC
Motif Score	3.622404762
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774476
mod ID: M6ASITE082082		Click to Show/Hide the Full List
mod site	chr7:122306916-122306917:+		[3]
Sequence	CTCCAAGGCGGCCCTTTGGAACCGTCCTTGGCCCGGGTGCA
Motif Score	2.930744048
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5; ENST00000424404.1
External Link	RMBase: m6A_site_774477
mod ID: M6ASITE082083		Click to Show/Hide the Full List
mod site	chr7:122306957-122306958:+		[3]
Sequence	CCTACTTTGGATTCGCCCAGACTGCAAATTTTTCTTTCCTT
Motif Score	3.319380952
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5; ENST00000424404.1
External Link	RMBase: m6A_site_774478
mod ID: M6ASITE082084		Click to Show/Hide the Full List
mod site	chr7:122307240-122307241:+		[2]
Sequence	ACAGATGGGTCGCGGTTAAGACTTTAATTGCTGACTTTTGG
Motif Score	3.319380952
Cell/Tissue List	H1A; GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000424404.1; ENST00000428449.5
External Link	RMBase: m6A_site_774479
mod ID: M6ASITE082085		Click to Show/Hide the Full List
mod site	chr7:122309606-122309607:+		[1]
Sequence	TGTGAGGTGTGTCCCTCCAGACTGAGAGGCTATGACTCAGG
Motif Score	3.319380952
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774480
mod ID: M6ASITE082086		Click to Show/Hide the Full List
mod site	chr7:122309632-122309633:+		[1]
Sequence	AGGCTATGACTCAGGGTTGGACTTTATGGAAAAAAAGAAGT
Motif Score	4.065041667
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774481
mod ID: M6ASITE082087		Click to Show/Hide the Full List
mod site	chr7:122309660-122309661:+		[1]
Sequence	GAAAAAAAGAAGTTTATAAAACAAGTAACCCAGTTTCTCCA
Motif Score	2.20572619
Cell/Tissue List	hNPCs; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774482
mod ID: M6ASITE082088		Click to Show/Hide the Full List
mod site	chr7:122309716-122309717:+		[1]
Sequence	CAACAGCGTCAAGCAACAAAACCCAGCAAAGTTTTGCTTGT
Motif Score	2.185083333
Cell/Tissue List	hNPCs; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774483
mod ID: M6ASITE082089		Click to Show/Hide the Full List
mod site	chr7:122309772-122309773:+		[1]
Sequence	TACTGAAATCTGGAAGGCGAACAATTAGAAGATAGCCCAAA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; hNPCs; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774484
mod ID: M6ASITE082090		Click to Show/Hide the Full List
mod site	chr7:122309792-122309793:+		[1]
Sequence	ACAATTAGAAGATAGCCCAAACATGCTCTATTGCTCTACAC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hNPCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774485
mod ID: M6ASITE082091		Click to Show/Hide the Full List
mod site	chr7:122309842-122309843:+		[1]
Sequence	TGCCTCCAATAATAGAAAAAACCTGTTTTCGTGCAATTGAT
Motif Score	2.185083333
Cell/Tissue List	HEK293T; hNPCs; hESCs; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774486
mod ID: M6ASITE082092		Click to Show/Hide the Full List
mod site	chr7:122309890-122309891:+		[1]
Sequence	CGTTCTGCAGCAGTCCCTGGACAATTTTAAAGACATTTTGT
Motif Score	3.643047619
Cell/Tissue List	HEK293T; hNPCs; hESCs; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774487
mod ID: M6ASITE082093		Click to Show/Hide the Full List
mod site	chr7:122309902-122309903:+		[1]
Sequence	GTCCCTGGACAATTTTAAAGACATTTTGTGTTTGTGGCCAA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hNPCs; hESCs; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774488
mod ID: M6ASITE082094		Click to Show/Hide the Full List
mod site	chr7:122309931-122309932:+		[1]
Sequence	GTTTGTGGCCAAAATTAGAAACAAGCAGACACACACACAAA
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hNPCs; hESCs; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774489
mod ID: M6ASITE082095		Click to Show/Hide the Full List
mod site	chr7:122309939-122309940:+		[1]
Sequence	CCAAAATTAGAAACAAGCAGACACACACACAAAACAACCAT
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hNPCs; hESCs; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774490
mod ID: M6ASITE082096		Click to Show/Hide the Full List
mod site	chr7:122309952-122309953:+		[1]
Sequence	CAAGCAGACACACACACAAAACAACCATATTCAAGACACGG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hNPCs; hESCs; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774491
mod ID: M6ASITE082097		Click to Show/Hide the Full List
mod site	chr7:122309967-122309968:+		[1]
Sequence	ACAAAACAACCATATTCAAGACACGGTTCGACTGTTTCCTT
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hNPCs; hESCs; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774492
mod ID: M6ASITE082098		Click to Show/Hide the Full List
mod site	chr7:122310032-122310033:+		[1]
Sequence	ATTTTTTATGTTATTTTCAAACTTTCTTAAGTGATCCCATG
Motif Score	2.627720238
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000428449.5
External Link	RMBase: m6A_site_774493

Ref 1	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 2	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 3	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map