m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00083)

Target Name	Apoptotic BCL2L1-antisense long non-coding RNA (ABALON)
Synonyms	ABALON; INXS; apoptotic BCL-X-associated long ncRNA; intronic BCL-XS-inducing lncRNA Click to Show/Hide
Gene Name	ABALON
Chromosomal Location	20q11.21
Family	Long non-coding RNAs with non-systematic symbols
Gene ID	103021294
HGNC ID	HGNC:49667

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ABALON can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Disease

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	Apoptotic BCL2L1-antisense long non-coding RNA (ABALON) acted as a competing endogenous RNA by sponging miR-139-3p and indirectly regulated the expression of NOB1 in the occurrence of lung cancer.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Pathway Response	T cell receptor signaling pathway	hsa04660
	Ribosome biogenesis in eukaryotes	hsa03008
Cell Process	Immune

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00083)

Apoptotic BCL2L1-antisense long non-coding RNA (ABALON)

N6-methyladenosine (m6A)

In total 15 m6A sequence/site(s) in this target gene
mod ID: M6ASITE052033		Click to Show/Hide the Full List
mod site	chr20:31721630-31721631:+		[1]
Sequence	CCAGAGGCCAAAGAAAAGGGACACACAAGGGGCTTGGTTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; U2OS; H1B; GM12878; H1299; Huh7; peripheral-blood; GSC-11; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526357
mod ID: M6ASITE052042		Click to Show/Hide the Full List
mod site	chr20:31721929-31721930:+		[1]
Sequence	CCGCCGGTACCGCAGTTCAAACTCGTCGCCTGCCTCCCTCA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526366
mod ID: M6ASITE052044		Click to Show/Hide the Full List
mod site	chr20:31721996-31721997:+		[1]
Sequence	ATCACCTCCCGGGCATCCAAACTGCTGCTGTGGCCAGTGGC
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526368
mod ID: M6ASITE052051		Click to Show/Hide the Full List
mod site	chr20:31722139-31722140:+		[1]
Sequence	GTTCTCTTCCACATCACTAAACTGACTCCAGCTGTATCCTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526375
mod ID: M6ASITE052054		Click to Show/Hide the Full List
mod site	chr20:31722214-31722215:+		[1]
Sequence	CAGCTCCCGGTTGCTCTGAGACATTTTTATAATAGGGATGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526378
mod ID: M6ASITE052057		Click to Show/Hide the Full List
mod site	chr20:31722258-31722259:+		[1]
Sequence	CAACCAGTCCATTGTCCAAAACACCTGCTCACTCACTGAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526381
mod ID: M6ASITE052060		Click to Show/Hide the Full List
mod site	chr20:31722420-31722421:+		[1]
Sequence	TTCCCCCTCCAGGTACCAGAACTGGTTTCTTTGTGGGTCTT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; HEK293A-TOA; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526384
mod ID: M6ASITE052066		Click to Show/Hide the Full List
mod site	chr20:31722502-31722503:+		[1]
Sequence	CAAATCGAAAGCACCAGTGGACTCTGAATCTCCCACCAGCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526390
mod ID: M6ASITE052068		Click to Show/Hide the Full List
mod site	chr20:31722746-31722747:+		[2]
Sequence	TCGCGGTGGCTGGCAAAAAAACCAGCTCCGGCCGGAGGGAT
Motif Score	2.185083333
Cell/Tissue List	HepG2; A549; HeLa; peripheral-blood; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526392
mod ID: M6ASITE052069		Click to Show/Hide the Full List
mod site	chr20:31722825-31722826:+		[1]
Sequence	AGGAATTGCGAAGCTCAGGAACCAGCCCCCTCGCTTGCTTC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; A549; HEK293T; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526393
mod ID: M6ASITE052070		Click to Show/Hide the Full List
mod site	chr20:31723122-31723123:+		[1]
Sequence	AGGGACGCAGGGAGGGGGAAACTGCCTCAGATCTGCAATCT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526394
mod ID: M6ASITE052071		Click to Show/Hide the Full List
mod site	chr20:31723193-31723194:+		[1]
Sequence	TGTGATGTTGAAGGCCGGAGACCCCCAACAAATGCCGCTGG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526395
mod ID: M6ASITE052072		Click to Show/Hide the Full List
mod site	chr20:31723285-31723286:+		[1]
Sequence	GTCCTCCATTCCCCGCCCGGACACAATGGCCGCCGGCGCCC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526396
mod ID: M6ASITE052073		Click to Show/Hide the Full List
mod site	chr20:31723315-31723316:+		[1]
Sequence	CGCCGGCGCCCTGCACAAAGACTGGGTGAGGGTGAGGCGCT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526397
mod ID: M6ASITE052074		Click to Show/Hide the Full List
mod site	chr20:31723395-31723396:+		[1]
Sequence	TCGACGGCCCCACAGCTGAGACCACGTTTTCCTGGGGACAG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000629058.1
External Link	RMBase: m6A_site_526398

Ref 1	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 2	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map