m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00081)

Target Name	Long intergenic non-protein coding RNA 1320 (LINC01320)
Synonyms	LINC01320 Click to Show/Hide
Gene Name	LINC01320
Chromosomal Location	2p22.3
Family	Long intergenic non-protein coding RNAs
Gene ID	104355288
HGNC ID	HGNC:50526

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

LINC01320 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In gastric cancer, METTL14 was involved in the m6A modification of LINC01320 and induced the up-regulation of Long intergenic non-protein coding RNA 1320 (LINC01320).
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MKN7	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1417
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	NCI-N87	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1603

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	In gastric cancer, METTL14 was involved in the m6A modification of LINC01320 and induced the up-regulation of Long intergenic non-protein coding RNA 1320 (LINC01320).
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MKN7	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1417
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	NCI-N87	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_1603

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03494		Crosstalk Info
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05499		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 1320 (LINC01320)
Regulated Target	hsa-miR-495-5p
Crosstalk relationship	m6A → ncRNA
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00081)

Long intergenic non-protein coding RNA 1320 (LINC01320)

Adenosine-to-Inosine editing (A-to-I)

In total 5 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009520		Click to Show/Hide the Full List
mod site	chr2:33713087-33713088:+		[2]
Sequence	GTCTTCCTAAAATGTAGAAAAGCAAGCTTCACCCTTACCAT
Transcript ID List	ENST00000442026.1; rmsk_506352; ENST00000366209.6
External Link	RMBase: RNA-editing_site_75340
mod ID: A2ISITE009521		Click to Show/Hide the Full List
mod site	chr2:33856261-33856262:+		[2]
Sequence	ATGAGGGTGGTTTCGTCCATACTCTTCTCATGGTAGTGAGT
Transcript ID List	ENST00000442026.1; ENST00000366209.6; rmsk_506655
External Link	RMBase: RNA-editing_site_75341
mod ID: A2ISITE009522		Click to Show/Hide the Full List
mod site	chr2:34498255-34498256:+		[2]
Sequence	GTGAAAACCTGTCTCTACTAAAAATACAAAAAATTAGCCAG
Transcript ID List	ENST00000422558.1; ENST00000650021.1; rmsk_507892
External Link	RMBase: RNA-editing_site_75342
mod ID: A2ISITE009523		Click to Show/Hide the Full List
mod site	chr2:34681982-34681983:+		[2]
Sequence	TGCAGTGGCTTGCGCCTGTAATCCCAGCACTTTGGGAAGCT
Transcript ID List	ENST00000627935.2; ENST00000626688.2; ENST00000616475.4; ENST00000625995.2; ENST00000630686.2; ENST00000604250.3; ENST00000628407.2; ENST00000423663.5; ENST00000626601.2; ENST00000650021.1; ENST00000626008.2; rmsk_508172; ENST00000627270.2
External Link	RMBase: RNA-editing_site_75343
mod ID: A2ISITE009524		Click to Show/Hide the Full List
mod site	chr2:34722681-34722682:+		[2]
Sequence	TCCCAAGTCCCAGCTACTCTACTTGGGAGGCTGAGGCAGAA
Transcript ID List	ENST00000630686.2; ENST00000628407.2; ENST00000625995.2; ENST00000627270.2; ENST00000616475.4; ENST00000626008.2; ENST00000650021.1; ENST00000603129.5; ENST00000453774.1; ENST00000626688.2; rmsk_508245; ENST00000626601.2
External Link	RMBase: RNA-editing_site_75344

N6-methyladenosine (m6A)

In total 10 m6A sequence/site(s) in this target gene
mod ID: M6ASITE044008		Click to Show/Hide the Full List
mod site	chr2:34677760-34677761:+		[3]
Sequence	GTGGAGCATCCCTGCAGGGGACTCTGGCCAGCCTGAGTGAC
Motif Score	4.065041667
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000650021.1; rmsk_508161; ENST00000423663.5; ENST00000625995.2
External Link	RMBase: m6A_site_467813
mod ID: M6ASITE044009		Click to Show/Hide the Full List
mod site	chr2:34677837-34677838:+		[3]
Sequence	GGGTGGAACGCCTCACCAGAACAGCACGTAGCAGGCCCCTG
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000626008.2; ENST00000423663.5; ENST00000625995.2; ENST00000650021.1; ENST00000628407.2; rmsk_508161; ENST00000627935.2
External Link	RMBase: m6A_site_467814
mod ID: M6ASITE044010		Click to Show/Hide the Full List
mod site	chr2:34677881-34677882:+		[3]
Sequence	AGGATTAACACAGTGGCTGAACACCGGGAAGGAACTGGCAC
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000630686.2; ENST00000423663.5; ENST00000626008.2; ENST00000626601.2; ENST00000625995.2; ENST00000604250.3; ENST00000626688.2; ENST00000627935.2; rmsk_508161; ENST00000650021.1; ENST00000628407.2; ENST00000616475.4
External Link	RMBase: m6A_site_467815
mod ID: M6ASITE044011		Click to Show/Hide the Full List
mod site	chr2:34677894-34677895:+		[3]
Sequence	TGGCTGAACACCGGGAAGGAACTGGCACTTGGAGTCCGGAC
Motif Score	3.373380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	rmsk_508161; ENST00000423663.5; ENST00000650021.1; ENST00000628407.2; ENST00000627935.2; ENST00000616475.4; ENST00000626688.2; ENST00000626008.2; ENST00000625995.2; ENST00000604250.3; ENST00000630686.2; ENST00000626601.2
External Link	RMBase: m6A_site_467816
mod ID: M6ASITE044012		Click to Show/Hide the Full List
mod site	chr2:34677913-34677914:+		[3]
Sequence	AACTGGCACTTGGAGTCCGGACATCTGAAACTTGGTAAGAC
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000627935.2; ENST00000627270.2; ENST00000630686.2; ENST00000626688.2; ENST00000423663.5; ENST00000616475.4; ENST00000650021.1; ENST00000604250.3; ENST00000626601.2; rmsk_508161; ENST00000625995.2; ENST00000628407.2; ENST00000626008.2
External Link	RMBase: m6A_site_467817
mod ID: M6ASITE044013		Click to Show/Hide the Full List
mod site	chr2:34677922-34677923:+		[3]
Sequence	TTGGAGTCCGGACATCTGAAACTTGGTAAGACTCGTCTTTG
Motif Score	2.627720238
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000628407.2; ENST00000626688.2; ENST00000616475.4; ENST00000626601.2; ENST00000627270.2; ENST00000423663.5; ENST00000625995.2; ENST00000650021.1; ENST00000630686.2; rmsk_508161; ENST00000604250.3; ENST00000627935.2; ENST00000626008.2
External Link	RMBase: m6A_site_467818
mod ID: M6ASITE044014		Click to Show/Hide the Full List
mod site	chr2:34691599-34691600:+		[3]
Sequence	TTTCATTTTAGATCTAGAGAACACATGCAATTTTGTTACAT
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000630686.2; ENST00000626601.2; ENST00000627935.2; ENST00000627270.2; ENST00000626688.2; ENST00000650021.1; ENST00000604250.3; ENST00000628407.2; ENST00000423663.5; ENST00000625995.2; ENST00000616475.4; ENST00000626008.2
External Link	RMBase: m6A_site_467819
mod ID: M6ASITE044015		Click to Show/Hide the Full List
mod site	chr2:34722088-34722089:+		[4]
Sequence	CGGAAGGTAGAAAGGGGAAAACTGTTGGGTGCTAAAATGAC
Motif Score	2.627720238
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000630686.2; ENST00000627270.2; ENST00000453774.1; ENST00000627935.2; ENST00000625995.2; ENST00000604250.3; ENST00000626601.2; ENST00000650021.1; ENST00000628407.2; ENST00000423663.5; ENST00000626008.2; ENST00000603129.5; ENST00000626688.2; ENST00000616475.4; ENST00000607437.3
External Link	RMBase: m6A_site_467820
mod ID: M6ASITE044016		Click to Show/Hide the Full List
mod site	chr2:34722789-34722790:+		[3]
Sequence	GGCAACAGAATGAGAATGAGACCCTGTCAAAAAAAAAAAAA
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000625995.2; rmsk_508245; ENST00000453774.1; ENST00000616475.4; ENST00000626601.2; ENST00000603129.5; ENST00000628407.2; ENST00000627270.2; ENST00000626008.2; ENST00000650021.1; ENST00000626688.2; ENST00000630686.2
External Link	RMBase: m6A_site_467821
mod ID: M6ASITE044017		Click to Show/Hide the Full List
mod site	chr2:34731458-34731459:+		[3]
Sequence	TCCTTCCAACTGAAAGGGAAACAAACAAGGAGGAGCACGCC
Motif Score	2.20572619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000603129.5; ENST00000627270.2; ENST00000628407.2; ENST00000453774.1; ENST00000626008.2; ENST00000625995.2; ENST00000630686.2; ENST00000626601.2; ENST00000626688.2; ENST00000616475.4
External Link	RMBase: m6A_site_467822

Ref 1	N6-methyladenosine (m6A)-mediated up-regulation of long noncoding RNA LINC01320 promotes the proliferation, migration, and invasion of gastric cancer via miR495-5p/RAB19 axis. Bioengineered. 2021 Dec;12(1):4081-4091. doi: 10.1080/21655979.2021.1953210.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 4	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map