m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00073)

Target Name	Long intergenic non-protein coding RNA 2604 (LINC02604/RP11-458F8.4)
Synonyms	LINC02604; lncHERG; highly expressed long noncoding RNA in glioblastoma Click to Show/Hide
Gene Name	LINC02604
Chromosomal Location	7q11.21
Family	Long intergenic non-protein coding RNAs
Gene ID	644794
HGNC ID	HGNC:53972

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

LINC02604 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Disease

Colon cancer [ICD-11: 2B90]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	Identified 10 upregulated m6A regulators at both mRNA and protein levels, and 2,479 m6A-related lncRNAs in colon adenocarcinoma. Functional inference suggested that CTD-3184A7.4, Long intergenic non-protein coding RNA 2604 (LINC02604/RP11-458F8.4), and RP11-108L7.15 were positively correlated with the energy metabolism-related pathways, further suggesting that these lncRNAs were involved in energy metabolism-related pathways.
Responsed Disease	Colon adenocarcinoma [ICD-11: 2B90.Y]
Cell Process	Energy metabolism

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00073)

Long intergenic non-protein coding RNA 2604 (LINC02604/RP11-458F8.4)

N6-methyladenosine (m6A)

In total 17 m6A sequence/site(s) in this target gene
mod ID: M6ASITE080380		Click to Show/Hide the Full List
mod site	chr7:66902987-66902988:+		[1]
Sequence	GGCCCAGCCCCTGCCTGCAGACAGCCGCTTTTGACTCGGTT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759738
mod ID: M6ASITE080381		Click to Show/Hide the Full List
mod site	chr7:66903043-66903044:+		[1]
Sequence	GCGGCCTTTGTAGGCCCGAAACCTCCTCCAGCACAGCTCTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759739
mod ID: M6ASITE080382		Click to Show/Hide the Full List
mod site	chr7:66903323-66903324:+		[1]
Sequence	TCCGCTGATGGCCTGTGCAGACCCAAAGTATCCTGAAGTCG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759740
mod ID: M6ASITE080383		Click to Show/Hide the Full List
mod site	chr7:66903413-66903414:+		[2]
Sequence	CTCTGCCTTCTAAAAGTGGAACCCCCCAGTCCCAGCTGTTG
Motif Score	2.930744048
Cell/Tissue List	HEK293T; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759741
mod ID: M6ASITE080384		Click to Show/Hide the Full List
mod site	chr7:66903653-66903654:+		[1]
Sequence	GCTCCTGGCAGCCTTTGTAAACCCCAGGATCCTCTAAGTCA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293A-TOA; iSLK; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759742
mod ID: M6ASITE080385		Click to Show/Hide the Full List
mod site	chr7:66904017-66904018:+		[2]
Sequence	GCAGCCTCTCCAGGCCCAGGACTTCCTCAAGTCGGCCTCTG
Motif Score	4.065041667
Cell/Tissue List	HEK293T; HEK293A-TOA; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759743
mod ID: M6ASITE080386		Click to Show/Hide the Full List
mod site	chr7:66904124-66904125:+		[1]
Sequence	GGCCCAGCTCCTGCCTCTGAACATCCTCCTGTGACTCGGCT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; GM12878; LCLs; MM6; HEK293A-TOA; TREX; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759744
mod ID: M6ASITE080387		Click to Show/Hide the Full List
mod site	chr7:66904173-66904174:+		[1]
Sequence	GCTCCCAGCGGCCTCCGTAGACCCGAAGCCTCCTCCGGTCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; GM12878; MM6; HEK293A-TOA; TREX; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759745
mod ID: M6ASITE080388		Click to Show/Hide the Full List
mod site	chr7:66904802-66904803:+		[3]
Sequence	ATTGTCCCTTCAGGCCCAGAACTTTCTCACGTCATCGTCAC
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759746
mod ID: M6ASITE080389		Click to Show/Hide the Full List
mod site	chr7:66904878-66904879:+		[3]
Sequence	GCCCAGCTTTTGCCTCATAAACTCAGCTCCTGTTTAATGGC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759747
mod ID: M6ASITE080390		Click to Show/Hide the Full List
mod site	chr7:66905067-66905068:+		[3]
Sequence	CCTAACAATGACCTCTTTAGACTCAGCTCATTTTCACTGCT
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759748
mod ID: M6ASITE080391		Click to Show/Hide the Full List
mod site	chr7:66905309-66905310:+		[3]
Sequence	TTAGGCCCGGCCTCTCCAGGACCAAAACATCCTTAAGTCAA
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759749
mod ID: M6ASITE080392		Click to Show/Hide the Full List
mod site	chr7:66905315-66905316:+		[3]
Sequence	CCGGCCTCTCCAGGACCAAAACATCCTTAAGTCAACCTCAC
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759750
mod ID: M6ASITE080393		Click to Show/Hide the Full List
mod site	chr7:66905506-66905507:+		[3]
Sequence	ACGGCCTCTGCAGGCCTAAAACTTCCTCAATTTGGCATCTC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759751
mod ID: M6ASITE080394		Click to Show/Hide the Full List
mod site	chr7:66905633-66905634:+		[3]
Sequence	CTTGTCTCTCCAGGCCTAGAACTTCCTCATGTTTACCTCAC
Motif Score	3.373380952
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759752
mod ID: M6ASITE080395		Click to Show/Hide the Full List
mod site	chr7:66905728-66905729:+		[3]
Sequence	TGGATCTCTCCAGGCCCCAAACTTTCTCAAGTCAACCTCAC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759753
mod ID: M6ASITE080396		Click to Show/Hide the Full List
mod site	chr7:66906047-66906048:+		[3]
Sequence	CTGGTCCTGCTTCCTGGTAGACTCTGCAGGCCCTGCTCCTG
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000610177.1
External Link	RMBase: m6A_site_759754

Ref 1	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 2	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 3	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map