m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00022)

Target Name	POU domain, class 5, transcription factor 1 (POU5F1)
Synonyms	Octamer-binding protein 3; Oct-3; Octamer-binding protein 4; Oct-4; Octamer-binding transcription factor 3; OTF-3; OCT3; OCT4; OTF3 Click to Show/Hide
Gene Name	POU5F1
Chromosomal Location	6p21.33
Family	POU transcription factor family; Class-5 subfamily
Function	Transcription factor that binds to the octamer motif (5'-ATTTGCAT-3'). Forms a trimeric complex with SOX2 or SOX15 on DNA and controls the expression of a number of genes involved in embryonic development such as YES1, FGF4, UTF1 and ZFP206. Critical for early embryogenesis and for embryonic stem cell pluripotency. Click to Show/Hide
Gene ID	5460
Uniprot ID	PO5F1_HUMAN
HGNC ID	HGNC:9221
KEGG ID	hsa:5460

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

POU5F1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene		[3]
Response Summary	YTHDF1 binds the m6A-modified POU domain, class 5, transcription factor 1 (POU5F1) mRNA.
Target Regulation	Up regulation

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	YTHDF2 promotes the CSC liver phenotype and cancer metastasis by modulating the m6A methylation of POU domain, class 5, transcription factor 1 (POU5F1) mRNA. YTHDF2 expression is positively correlated with OCT4 expression and m6A levels in the 5'-UTR of OCT4 mRNA in clinical hepatocellular carcinoma specimens.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	RNA degradation			hsa03018
Cell Process	Cancer metastasis
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	YTHDF2 promotes the CSC liver phenotype and cancer metastasis by modulating the m6A methylation of POU domain, class 5, transcription factor 1 (POU5F1) mRNA. YTHDF2 expression is positively correlated with OCT4 expression and m6A levels in the 5'-UTR of OCT4 mRNA in clinical hepatocellular carcinoma specimens.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	RNA degradation			hsa03018
Cell Process	Cancer metastasis
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03410		Crosstalk Info
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info
Crosstalk ID: M6ACROT03421		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info

Non-coding RNA

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05038		Crosstalk Info
Epigenetic Regulator	MicroRNA 145 (MIR145)
Regulated Target	YTH domain-containing family protein 2 (YTHDF2)
Crosstalk relationship	ncRNA → m6A
Disease	Liver cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00022)

POU domain, class 5, transcription factor 1 (POU5F1)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000101		Click to Show/Hide the Full List
mod site	chr6:31164362-31164363:-		[6]
Sequence	TTTTTCTTAAATAAAGAAGCCTGGGACACAGTAGATAGACA
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000606567.5; ENST00000259915.13; ENST00000441888.7; ENST00000471529.6; ENST00000513407.1; ENST00000512818.5
External Link	RMBase: ac4C_site_1576

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001425		Click to Show/Hide the Full List
mod site	chr6:31171111-31171112:-		[7]
Sequence	TTTCTTGAGGACAGGAATTCAAGACCAGCCTGGGTAACATA
Transcript ID List	ENST00000441888.7; rmsk_1907496
External Link	RMBase: RNA-editing_site_115349

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000394		Click to Show/Hide the Full List
mod site	chr6:31166442-31166443:-		[8]
Sequence	TGGTCTTGAACTCCTGACCTCGTGATCTGCCCACCTCGGCC
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000461401.1; ENST00000606567.5; ENST00000471529.6; ENST00000259915.13; ENST00000512818.5; ENST00000441888.7; ENST00000513407.1
External Link	RMBase: Nm_site_5795

N6-methyladenosine (m6A)

In total 10 m6A sequence/site(s) in this target gene
mod ID: M6ASITE074307		Click to Show/Hide the Full List
mod site	chr6:31164357-31164358:-		[9]
Sequence	CTTAAATAAAGAAGCCTGGGACACAGTAGATAGACACACTT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000441888.7; ENST00000606567.5; ENST00000259915.13; ENST00000471529.6; ENST00000513407.1; ENST00000512818.5
External Link	RMBase: m6A_site_711956
mod ID: M6ASITE074308		Click to Show/Hide the Full List
mod site	chr6:31164397-31164398:-		[9]
Sequence	ATGCTCTTGATTTTAATCCCACATCATGTATCACTTTTTTC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000259915.13; ENST00000441888.7; ENST00000512818.5; ENST00000606567.5; ENST00000471529.6; ENST00000513407.1
External Link	RMBase: m6A_site_711957
mod ID: M6ASITE074309		Click to Show/Hide the Full List
mod site	chr6:31164804-31164805:-		[9]
Sequence	CGATCAAGCAGCGACTATGCACAACGAGAGGATTTTGAGGC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000259915.13; ENST00000620031.5; ENST00000512818.5; ENST00000441888.7; ENST00000513407.1; ENST00000606567.5; ENST00000471529.6
External Link	RMBase: m6A_site_711958
mod ID: M6ASITE074310		Click to Show/Hide the Full List
mod site	chr6:31165158-31165159:-		[9]
Sequence	CACACTGCAGCAGATCAGCCACATCGCCCAGCAGCTTGGGC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000441888.7; ENST00000620031.5; ENST00000606567.5; ENST00000512818.5; ENST00000259915.13; ENST00000471529.6; ENST00000513407.1
External Link	RMBase: m6A_site_711959
mod ID: M6ASITE074311		Click to Show/Hide the Full List
mod site	chr6:31165177-31165178:-		[9]
Sequence	TCCTGCAGTGCCCGAAACCCACACTGCAGCAGATCAGCCAC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000620031.5; ENST00000441888.7; ENST00000259915.13; ENST00000513407.1; ENST00000606567.5; ENST00000512818.5; ENST00000471529.6
External Link	RMBase: m6A_site_711960
mod ID: M6ASITE074312		Click to Show/Hide the Full List
mod site	chr6:31165589-31165590:-		[9]
Sequence	GTGGGTGGAGGAAGCTGACAACAATGAAAATCTTCAGGAGG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000606567.5; ENST00000471529.6; ENST00000512818.5; ENST00000513407.1; ENST00000441888.7; ENST00000620031.5; ENST00000259915.13
External Link	RMBase: m6A_site_711961
mod ID: M6ASITE074313		Click to Show/Hide the Full List
mod site	chr6:31165592-31165593:-		[9]
Sequence	GAAGTGGGTGGAGGAAGCTGACAACAATGAAAATCTTCAGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000606567.5; ENST00000441888.7; ENST00000512818.5; ENST00000620031.5; ENST00000513407.1; ENST00000471529.6; ENST00000259915.13
External Link	RMBase: m6A_site_711962
mod ID: M6ASITE074314		Click to Show/Hide the Full List
mod site	chr6:31165640-31165641:-		[9]
Sequence	TCTGCAGCTTAGCTTCAAGAACATGTGTAAGCTGCGGCCCT
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000606567.5; ENST00000441888.7; ENST00000471529.6; ENST00000513407.1; ENST00000512818.5; ENST00000259915.13; ENST00000620031.5
External Link	RMBase: m6A_site_711963
mod ID: M6ASITE074315		Click to Show/Hide the Full List
mod site	chr6:31165965-31165966:-		[9]
Sequence	AGAGGATCACCCTGGGATATACACAGGCCGATGTGGGGCTC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000513407.1; ENST00000606567.5; ENST00000471529.6; ENST00000259915.13; ENST00000512818.5; ENST00000461401.1; ENST00000441888.7
External Link	RMBase: m6A_site_711964
mod ID: M6ASITE074316		Click to Show/Hide the Full List
mod site	chr6:31166039-31166040:-		[9]
Sequence	TTTTAAAATCCAGTCCCAGGACATCAAAGCTCTGCAGAAAG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000259915.13; ENST00000461401.1; ENST00000441888.7; ENST00000513407.1; ENST00000471529.6; ENST00000606567.5; ENST00000512818.5
External Link	RMBase: m6A_site_711965

Ref 1	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 2	Structure-based optimization of phenylbutyrate-derived histone deacetylase inhibitors. J Med Chem. 2005 Aug 25;48(17):5530-5. doi: 10.1021/jm0503749.
Ref 3	Multilayer and MATR3-dependent regulation of mRNAs maintains pluripotency in human induced pluripotent stem cells. iScience. 2021 Feb 16;24(3):102197. doi: 10.1016/j.isci.2021.102197. eCollection 2021 Mar 19.
Ref 4	P-glycoprotein Mediates Ceritinib Resistance in Anaplastic Lymphoma Kinase-rearranged Non-small Cell Lung Cancer. EBioMedicine. 2015 Dec 12;3:54-66. doi: 10.1016/j.ebiom.2015.12.009. eCollection 2016 Jan.
Ref 5	YTHDF2 promotes the liver cancer stem cell phenotype and cancer metastasis by regulating OCT4 expression via m6A RNA methylation. Oncogene. 2020 Jun;39(23):4507-4518. doi: 10.1038/s41388-020-1303-7. Epub 2020 May 4.
Ref 6	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 7	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 8	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map