Epigenetic Target Information

General Information of the Epigenetic Target (ID: EPITAR00460)
Target Name hsa-miR-7-5p
Gene Name hsa-miR-7-5p
miRBase ID MIMAT0000252
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00460)
hsa-miR-7-5p
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007049 Click to Show/Hide the Full List
mod site chr15:88611864-88611865:+ [1]
Sequence CTGGCCCCATCTGGAAGACTAGTGATTTTGTTGTTGTCTTA
Transcript ID List ENST00000384970.1; MIMAT0000252
External Link RMBase: RNA-editing_site_46041