Epigenetic Target Information

General Information of the Epigenetic Target (ID: EPITAR00444)
Target Name hsa-miR-423-5p
Gene Name hsa-miR-423-5p
miRBase ID MIMAT0004748
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00444)
hsa-miR-423-5p
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE031363 Click to Show/Hide the Full List
mod site chr17:30117112-30117113:+ [1]
Sequence GCTGAGGGGCAGAGAGCGAGACTTTTCTATTTTCCAAAAGC
Motif Score 3.319380952
Cell/Tissue List HeLa; BGC823; MM6; Huh7; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000479218.6; ENST00000362201.2; ENST00000612959.4; ENST00000247026.10; ENST00000583301.5; ENST00000585881.5; ENST00000577289.6; ENST00000475652.5; MIMAT0004748; ENST00000394826.8; ENST00000584154.5; ENST00000584423.5; ENST00000540900.7; ENST00000584317.5
External Link RMBase: m6A_site_356324