General Information of the Epigenetic Target (ID: EPITAR00395)
Target Name Interleukin-33 (IL33)
Synonyms
IL-33; Interleukin-1 family member 11; Nuclear factor from high endothelial venules; IL-1F11; NF-HEV
    Click to Show/Hide
Gene Name IL33
Sequence
MKPKMKYSTNKISTAKWKNTASKALCFKLGKSQQKAKEVCPMYFMKLRSGLMIKKEACYFRRETTKRPSLKTGRKHKRHLVLAACQQQSTVECFAFGISGVQKYTRALHDSSITGISPITEYLASLSTYNDQSITFALEDESYEIYVEDLKKDEKKDKVLLSYYESQHPSNESGDGVDGKMLMVTLSPTKDFWLHANNKEHSVELHKCEKPLPDQAFFVLHNMHSNCVSFECKTDPGVFIGVKDNHLALIKVDSSENLCTENILFKLSET
    Click to Show/Hide
Family IL-1 family
Function
Cytokine that binds to and signals through the IL1RL1/ST2 receptor which in turn activates NF-kappa-B and MAPK signaling pathways in target cells (PubMed:16286016, PubMed:19841166). Involved in the maturation of Th2 cells inducing the secretion of T-helper type 2-associated cytokines (PubMed:17853410, PubMed:18836528). Also involved in activation of mast cells, basophils, eosinophils and natural killer cells (PubMed:17853410, PubMed:18836528). Acts as an enhancer of polarization of alternatively activated macrophages (PubMed:19841166). Acts as a chemoattractant for Th2 cells, and may function as an 'alarmin', that amplifies immune responses during tissue injury (PubMed:17853410, PubMed:18836528). Induces rapid UCP2-dependent mitochondrial rewiring that attenuates the generation of reactive oxygen species and preserves the integrity of Krebs cycle required for persistent production of itaconate and subsequent GATA3-dependent differentiation of inflammation-resolving alternatively activated macrophages (By similarity).
    Click to Show/Hide
Gene ID 90865
HGNC ID HGNC:16028
Ensembl Gene ID ENSG00000137033
KEGG ID hsa:90865
Chromosomal Location 9p24.1
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00395)
Interleukin-33 (IL33)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003071 Click to Show/Hide the Full List
mod site chr9:6235309-6235310:+ [1]
Sequence CTGCTTAGGCCTCCCAATGCACTGGGATTACAGGCATGAGA
Transcript ID List ENST00000417746.6
External Link RMBase: RNA-editing_site_134296
mod ID: A2ISITE003072 Click to Show/Hide the Full List
mod site chr9:6243291-6243292:+ [1]
Sequence AGCTATAGCTCTGAGATTAAAGGGCTGTATAACTCTTTGAT
Transcript ID List ENST00000611532.4; ENST00000381434.7; ENST00000417746.6; ENST00000456383.3
External Link RMBase: RNA-editing_site_134297
N6-methyladenosine (m6A)
In total 4 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087616 Click to Show/Hide the Full List
mod site chr9:6215794-6215795:+ [2]
Sequence CTAATAAAAAGAGTCTACAGACTCCTCCGAACACAGAGCTG
Motif Score 3.319380952
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000417746.6
External Link RMBase: m6A_site_815802
mod ID: M6ASITE087617 Click to Show/Hide the Full List
mod site chr9:6215804-6215805:+ [2]
Sequence GAGTCTACAGACTCCTCCGAACACAGAGCTGCAGCTCTTCA
Motif Score 2.951386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000417746.6
External Link RMBase: m6A_site_815803
mod ID: M6ASITE087618 Click to Show/Hide the Full List
mod site chr9:6215839-6215840:+ [3]
Sequence TCTTCAGGGAAGAAATCAAAACAAGATCACAAGGTAAGACT
Motif Score 2.20572619
Cell/Tissue List MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000417746.6
External Link RMBase: m6A_site_815804
mod ID: M6ASITE087619 Click to Show/Hide the Full List
mod site chr9:6241749-6241750:+ [3]
Sequence TTCCACAGCAAAGTGGAAGAACACAGCAAGCAAAGCCTTGT
Motif Score 2.951386905
Cell/Tissue List MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000463336.1; ENST00000611532.4; ENST00000417746.6; ENST00000456383.3; ENST00000381434.7
External Link RMBase: m6A_site_815805