Epigenetic Target Information

General Information of the Epigenetic Target (ID: EPITAR00342)
Target Name hsa-miR-140-3p
Gene Name hsa-miR-140-3p
miRBase ID MIMAT0004597
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00342)
hsa-miR-140-3p
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE028304 Click to Show/Hide the Full List
mod site chr16:69933155-69933156:+ [1]
Sequence CTGTTCTACCACAGGGTAGAACCACGGACAGGATACCGGGG
Motif Score 2.930744048
Cell/Tissue List BGC823
Seq Type List m6A-seq
Transcript ID List ENST00000566463.5; ENST00000544162.5; ENST00000568684.1; ENST00000569297.5; MIMAT0004597; ENST00000356003.6; ENST00000359154.6; ENST00000568818.1; ENST00000385282.3
External Link RMBase: m6A_site_328684