Epigenetic Target Information

General Information of the Epigenetic Target (ID: EPITAR00319)
Target Name hsa-miR-199a-5p
Gene Name hsa-miR-199a-5p
miRBase ID MIMAT0000231
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00319)
hsa-miR-199a-5p
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE067096 Click to Show/Hide the Full List
mod site chr1:172144601-172144602:- [1]
Sequence TCCGTCGCCCCAGTGTTCAGACTACCTGTTCAGGACAATGC
Motif Score 3.319380952
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000417354.3; ENST00000385289.1; MIMAT0000231; ENST00000650189.1; ENST00000648909.1
External Link RMBase: m6A_site_64744