Epigenetic Target Information
General Information of the Epigenetic Target (ID: EPITAR00280)
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00280)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE003255 | Click to Show/Hide the Full List | ||
| mod site | chr9:123111571-123111572:- | [1] | |
| Sequence | AGTGGAGTTACTTACAGACAAGAGCCTTGCTCAGGCCAGCC | ||
| Transcript ID List | ENST00000471564.6; MIMAT0003268; ENST00000385007.1; ENST00000478973.6; ENST00000449175.1; ENST00000530364.1; ENST00000545631.2 | ||
| External Link | RMBase: RNA-editing_site_137493 | ||
References
Back to top