Epigenetic Target Information
General Information of the Epigenetic Target (ID: EPITAR00252)
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00252)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE010249 | Click to Show/Hide the Full List | ||
| mod site | chr2:219294131-219294132:- | [1] | |
| Sequence | TCCAGTTGCATAGTCACAAAAGTGATCATTGGCAGGTGTGG | ||
| Transcript ID List | ENST00000295718.7; ENST00000423636.6; ENST00000384914.1; ENST00000497977.1; ENST00000409251.7; ENST00000443981.5; ENST00000462351.5; MIMAT0000439 | ||
| External Link | RMBase: RNA-editing_site_83751 | ||
References
Back to top