Epigenetic Target Information
General Information of the Epigenetic Target (ID: EPITAR00178)
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00178)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE011934 | Click to Show/Hide the Full List | ||
| mod site | chr3:50176499-50176500:+ | [1] | |
| Sequence | CCACTCCATGTCCATCTCATAGCCCACAAGGCAGGGCCCCT | ||
| Transcript ID List | ENST00000002829.8; ENST00000420831.1; ENST00000450338.5; ENST00000434342.5; ENST00000414301.5; ENST00000413852.5 | ||
| External Link | RMBase: RNA-editing_site_97081 | ||
5-methylcytidine (m5C)
| In total 8 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE003101 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155347-50155348:+ | [2] | |
| Sequence | GCCCCTGAGCCTTCCCATGGCCCGGGCTGGGGCCCGGGCCC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000414301.5; ENST00000413852.5; ENST00000450338.5 | ||
| External Link | RMBase: m5C_site_32263 | ||
| mod ID: M5CSITE003102 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155348-50155349:+ | [2] | |
| Sequence | CCCCTGAGCCTTCCCATGGCCCGGGCTGGGGCCCGGGCCCT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000002829.8; ENST00000414301.5; ENST00000413852.5 | ||
| External Link | RMBase: m5C_site_32264 | ||
| mod ID: M5CSITE003103 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155349-50155350:+ | [2] | |
| Sequence | CCCTGAGCCTTCCCATGGCCCGGGCTGGGGCCCGGGCCCTC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000450338.5; ENST00000414301.5; ENST00000413852.5 | ||
| External Link | RMBase: m5C_site_32265 | ||
| mod ID: M5CSITE003104 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155359-50155360:+ | [2] | |
| Sequence | TCCCATGGCCCGGGCTGGGGCCCGGGCCCTCGGCTGCTGAC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000414301.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m5C_site_32266 | ||
| mod ID: M5CSITE003105 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155360-50155361:+ | [2] | |
| Sequence | CCCATGGCCCGGGCTGGGGCCCGGGCCCTCGGCTGCTGACG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000414301.5; ENST00000002829.8; ENST00000450338.5 | ||
| External Link | RMBase: m5C_site_32267 | ||
| mod ID: M5CSITE003106 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155361-50155362:+ | [2] | |
| Sequence | CCATGGCCCGGGCTGGGGCCCGGGCCCTCGGCTGCTGACGC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000450338.5; ENST00000414301.5; ENST00000413852.5 | ||
| External Link | RMBase: m5C_site_32268 | ||
| mod ID: M5CSITE003107 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155365-50155366:+ | [2] | |
| Sequence | GGCCCGGGCTGGGGCCCGGGCCCTCGGCTGCTGACGCGCCC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000450338.5; ENST00000414301.5; ENST00000002829.8 | ||
| External Link | RMBase: m5C_site_32269 | ||
| mod ID: M5CSITE003108 | Click to Show/Hide the Full List | ||
| mod site | chr3:50182751-50182752:+ | ||
| Sequence | AGAGGCGCCGCAGAGCCCCGCGGTGTACGCCCGCATCGGGC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000450338.5; ENST00000002829.8; ENST00000413852.5; ENST00000434342.5; ENST00000493743.1 | ||
| External Link | RMBase: m5C_site_32270 | ||
N6-methyladenosine (m6A)
| In total 51 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE061155 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155086-50155087:+ | [3] | |
| Sequence | GTCCCGCCGGCGGCCGCGAGACCAGAGCGAGCGAACGAACC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000450338.5 | ||
| External Link | RMBase: m6A_site_591543 | ||
| mod ID: M6ASITE061156 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155104-50155105:+ | [3] | |
| Sequence | AGACCAGAGCGAGCGAACGAACCGCGGCGGTCCGGAGAGCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000414301.5; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591544 | ||
| mod ID: M6ASITE061157 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155141-50155142:+ | [3] | |
| Sequence | AGCCCCGAGCGCAGCGCAGGACCTGGGTACGCCGCGAGGAA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; iSLK; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000450338.5; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591545 | ||
| mod ID: M6ASITE061158 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155161-50155162:+ | [3] | |
| Sequence | ACCTGGGTACGCCGCGAGGAACCGTGCAGCCCAGCGCGGCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; iSLK; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000413852.5; ENST00000450338.5 | ||
| External Link | RMBase: m6A_site_591546 | ||
| mod ID: M6ASITE061159 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155579-50155580:+ | [3] | |
| Sequence | AAGAGGTGAGTGCAGCGGGAACCGGGAGGGAGCGGGCAGGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000414301.5; ENST00000426511.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591547 | ||
| mod ID: M6ASITE061160 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155628-50155629:+ | [3] | |
| Sequence | CACCCCGCGACCCCTCTGGGACCCGCGGCACTGCAACTCCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000413852.5; ENST00000426511.5; ENST00000002829.8; ENST00000450338.5 | ||
| External Link | RMBase: m6A_site_591548 | ||
| mod ID: M6ASITE061161 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155698-50155699:+ | [3] | |
| Sequence | AGCCGGGGGGCTGCCCGCGGACATAGGGGCAACAAGGCTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000426511.5; ENST00000414301.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591549 | ||
| mod ID: M6ASITE061162 | Click to Show/Hide the Full List | ||
| mod site | chr3:50155750-50155751:+ | [3] | |
| Sequence | TACCTGTCCTGGAGGCCCGGACCCCTTACCTACGGGGCGGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000450338.5; ENST00000002829.8; ENST00000426511.5; ENST00000414301.5 | ||
| External Link | RMBase: m6A_site_591550 | ||
| mod ID: M6ASITE061163 | Click to Show/Hide the Full List | ||
| mod site | chr3:50159619-50159620:+ | [4] | |
| Sequence | CTGGGCCCTAGGCCCCTCCCACAATGCTTGTCGCCGGTCTT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000434342.5; ENST00000450338.5; ENST00000414301.5; ENST00000426511.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591551 | ||
| mod ID: M6ASITE061164 | Click to Show/Hide the Full List | ||
| mod site | chr3:50159692-50159693:+ | [3] | |
| Sequence | GCCATCCTTCCCCACCCAGGACCACCTCCCGGCCACGCCCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000434342.5; ENST00000413852.5; ENST00000414301.5; ENST00000450338.5; ENST00000426511.5 | ||
| External Link | RMBase: m6A_site_591552 | ||
| mod ID: M6ASITE061165 | Click to Show/Hide the Full List | ||
| mod site | chr3:50173873-50173874:+ | [3] | |
| Sequence | AATCTTGCTCAAGGACGAGGACCACGACCGCATGTACGTGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000434342.5; ENST00000413852.5; ENST00000414301.5; ENST00000420831.1; ENST00000002829.8; ENST00000426511.5 | ||
| External Link | RMBase: m6A_site_591553 | ||
| mod ID: M6ASITE061166 | Click to Show/Hide the Full List | ||
| mod site | chr3:50173903-50173904:+ | [3] | |
| Sequence | CATGTACGTGGGCAGCAAGGACTACGTGCTGTCCCTGGACC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000426511.5; ENST00000450338.5; ENST00000414301.5; ENST00000420831.1; ENST00000413852.5; ENST00000434342.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591554 | ||
| mod ID: M6ASITE061167 | Click to Show/Hide the Full List | ||
| mod site | chr3:50173921-50173922:+ | [3] | |
| Sequence | GGACTACGTGCTGTCCCTGGACCTGCACGACATCAACCGCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000413852.5; ENST00000414301.5; ENST00000420831.1; ENST00000450338.5; ENST00000426511.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591555 | ||
| mod ID: M6ASITE061168 | Click to Show/Hide the Full List | ||
| mod site | chr3:50173930-50173931:+ | [4] | |
| Sequence | GCTGTCCCTGGACCTGCACGACATCAACCGCGAGCCCCTCA | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000434342.5; ENST00000414301.5; ENST00000426511.5; ENST00000420831.1; ENST00000413852.5; ENST00000450338.5 | ||
| External Link | RMBase: m6A_site_591556 | ||
| mod ID: M6ASITE061169 | Click to Show/Hide the Full List | ||
| mod site | chr3:50174243-50174244:+ | [3] | |
| Sequence | GCCCCAGGGCGAGTGTGGGAACTTCGTCAGGCTCATCCAGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000413852.5; ENST00000434342.5; ENST00000420831.1; ENST00000450338.5; ENST00000414301.5 | ||
| External Link | RMBase: m6A_site_591557 | ||
| mod ID: M6ASITE061170 | Click to Show/Hide the Full List | ||
| mod site | chr3:50174270-50174271:+ | [3] | |
| Sequence | CAGGCTCATCCAGCCCTGGAACCGAACACACCTGTATGTGT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000434342.5; ENST00000414301.5; ENST00000450338.5; ENST00000420831.1; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591558 | ||
| mod ID: M6ASITE061171 | Click to Show/Hide the Full List | ||
| mod site | chr3:50174275-50174276:+ | [3] | |
| Sequence | TCATCCAGCCCTGGAACCGAACACACCTGTATGTGTGCGGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420831.1; ENST00000002829.8; ENST00000434342.5; ENST00000414301.5; ENST00000450338.5; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591559 | ||
| mod ID: M6ASITE061172 | Click to Show/Hide the Full List | ||
| mod site | chr3:50174296-50174297:+ | [3] | |
| Sequence | CACACCTGTATGTGTGCGGGACAGGTGCCTACAACCCCATG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000420831.1; ENST00000413852.5; ENST00000002829.8; ENST00000434342.5; ENST00000450338.5 | ||
| External Link | RMBase: m6A_site_591560 | ||
| mod ID: M6ASITE061173 | Click to Show/Hide the Full List | ||
| mod site | chr3:50174330-50174331:+ | [3] | |
| Sequence | CCCCATGTGCACCTATGTGAACCGCGGACGCCGCGCCCAGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000420831.1; ENST00000414301.5; ENST00000434342.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591561 | ||
| mod ID: M6ASITE061174 | Click to Show/Hide the Full List | ||
| mod site | chr3:50175107-50175108:+ | [3] | |
| Sequence | CTTCTCAGGCCACACCATGGACCCAGACTCAGGCGGTCAGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000420831.1; ENST00000002829.8; ENST00000434342.5; ENST00000450338.5; ENST00000414301.5 | ||
| External Link | RMBase: m6A_site_591562 | ||
| mod ID: M6ASITE061175 | Click to Show/Hide the Full List | ||
| mod site | chr3:50175113-50175114:+ | [3] | |
| Sequence | AGGCCACACCATGGACCCAGACTCAGGCGGTCAGAGGCCGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000450338.5; ENST00000420831.1; ENST00000002829.8; ENST00000413852.5; ENST00000414301.5; ENST00000434342.5 | ||
| External Link | RMBase: m6A_site_591563 | ||
| mod ID: M6ASITE061176 | Click to Show/Hide the Full List | ||
| mod site | chr3:50176771-50176772:+ | [4] | |
| Sequence | CCGCTCTGCCTTACAGGATTACATCTTCTACCTGGAGCCTG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000420831.1; ENST00000414301.5; ENST00000450338.5; ENST00000434342.5; ENST00000413852.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591564 | ||
| mod ID: M6ASITE061177 | Click to Show/Hide the Full List | ||
| mod site | chr3:50176840-50176841:+ | [3] | |
| Sequence | TCCGTACGATCCCAAGCTGGACACAGCATCGGCCCTCATCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000434342.5; ENST00000450338.5; ENST00000413852.5; ENST00000414301.5; ENST00000420831.1 | ||
| External Link | RMBase: m6A_site_591565 | ||
| mod ID: M6ASITE061178 | Click to Show/Hide the Full List | ||
| mod site | chr3:50182360-50182361:+ | [3] | |
| Sequence | TCCGCACACTTGGAAAGCAGACAGCCATGCGCACGGATCAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000002829.8; ENST00000413852.5; ENST00000434342.5; ENST00000450338.5 | ||
| External Link | RMBase: m6A_site_591566 | ||
| mod ID: M6ASITE061179 | Click to Show/Hide the Full List | ||
| mod site | chr3:50182382-50182383:+ | [4] | |
| Sequence | AGCCATGCGCACGGATCAGTACAACTCCCGGTGGCTGAACG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000414301.5; ENST00000450338.5; ENST00000002829.8; ENST00000434342.5; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591567 | ||
| mod ID: M6ASITE061180 | Click to Show/Hide the Full List | ||
| mod site | chr3:50182643-50182644:+ | [3] | |
| Sequence | CTGACCCCTGCCACCTGCAGACCCGTCGTTCATCCATGCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000450338.5; ENST00000434342.5; ENST00000414301.5; ENST00000002829.8; ENST00000493743.1 | ||
| External Link | RMBase: m6A_site_591568 | ||
| mod ID: M6ASITE061181 | Click to Show/Hide the Full List | ||
| mod site | chr3:50182945-50182946:+ | [4] | |
| Sequence | GCCTGGTCAACAAGTGGAGCACATTCCTGAAGGCGCGGCTC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000002829.8; ENST00000493743.1; ENST00000434342.5; ENST00000450338.5 | ||
| External Link | RMBase: m6A_site_591569 | ||
| mod ID: M6ASITE061182 | Click to Show/Hide the Full List | ||
| mod site | chr3:50182999-50183000:+ | [3] | |
| Sequence | CGGGCGAGGATGGCATTGAGACTCACTTTGATGAGCTCCGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000450338.5; ENST00000434342.5; ENST00000493743.1; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591570 | ||
| mod ID: M6ASITE061183 | Click to Show/Hide the Full List | ||
| mod site | chr3:50185450-50185451:+ | [3] | |
| Sequence | GGCCCGTTCCAGACCGCGGGACAGTGCAGAAGGTCATTGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000470737.1; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591571 | ||
| mod ID: M6ASITE061184 | Click to Show/Hide the Full List | ||
| mod site | chr3:50185683-50185684:+ | [5] | |
| Sequence | AGGATCCAGCACCCGTCAAGACCATGACCATCTCTTCTAAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591572 | ||
| mod ID: M6ASITE061185 | Click to Show/Hide the Full List | ||
| mod site | chr3:50187717-50187718:+ | [3] | |
| Sequence | CCTGCAGATTCGTGCAGAGGACCGCTTCCTGCGCACAGAGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000002829.8; ENST00000434342.5 | ||
| External Link | RMBase: m6A_site_591573 | ||
| mod ID: M6ASITE061186 | Click to Show/Hide the Full List | ||
| mod site | chr3:50187804-50187805:+ | [3] | |
| Sequence | CTCCTGCACAGCCACTGAGAACAACTTTAAGCACGTCGTCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000434342.5; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591574 | ||
| mod ID: M6ASITE061187 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188068-50188069:+ | [3] | |
| Sequence | CCGGTCTCCTGAGCCCCAGGACCAGAAAAAGCCCCGGAACC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; hNPCs; hESCs; A549; MM6; HEK293A-TOA; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000413852.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591575 | ||
| mod ID: M6ASITE061188 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188086-50188087:+ | [3] | |
| Sequence | GGACCAGAAAAAGCCCCGGAACCGCCGGCACCACCCTCCGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; hNPCs; hESCs; A549; MM6; HEK293A-TOA; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000002829.8; ENST00000413852.5; ENST00000434342.5 | ||
| External Link | RMBase: m6A_site_591576 | ||
| mod ID: M6ASITE061189 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188107-50188108:+ | [3] | |
| Sequence | CCGCCGGCACCACCCTCCGGACACATGAGGCCAGCTGCCTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; hESC-HEK293T; H1A; H1B; hNPCs; hESCs; A549; MM6; HEK293A-TOA; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591577 | ||
| mod ID: M6ASITE061190 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188237-50188238:+ | [3] | |
| Sequence | CACACCCTGCCCCTGCAAAGACAGTATTTATTGGTGGGTTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1B; hNPCs; hESCs; fibroblasts; MM6; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000002829.8; ENST00000434342.5 | ||
| External Link | RMBase: m6A_site_591578 | ||
| mod ID: M6ASITE061191 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188292-50188293:+ | [3] | |
| Sequence | CAGTGGCAGCATCCTCCAAAACTTAGACCCATGCTGGTCAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000434342.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591579 | ||
| mod ID: M6ASITE061192 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188298-50188299:+ | [3] | |
| Sequence | CAGCATCCTCCAAAACTTAGACCCATGCTGGTCAGAGACGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000434342.5; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591580 | ||
| mod ID: M6ASITE061193 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188325-50188326:+ | [3] | |
| Sequence | CTGGTCAGAGACGGCAGAAAACAGAGCCTGCCTAACCAGGC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000413852.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591581 | ||
| mod ID: M6ASITE061194 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188373-50188374:+ | [3] | |
| Sequence | GTTGGTGGGGCCAGGCCAGGACCACACAGTCCCCAGACTCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000002829.8; ENST00000434342.5 | ||
| External Link | RMBase: m6A_site_591582 | ||
| mod ID: M6ASITE061195 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188389-50188390:+ | [3] | |
| Sequence | CAGGACCACACAGTCCCCAGACTCAGCTGGAAGTCTACCTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000434342.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591583 | ||
| mod ID: M6ASITE061196 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188414-50188415:+ | [3] | |
| Sequence | GCTGGAAGTCTACCTGCTGGACAGCCTCCGCCAAGATCTAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000434342.5; ENST00000413852.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591584 | ||
| mod ID: M6ASITE061197 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188438-50188439:+ | [3] | |
| Sequence | CCTCCGCCAAGATCTACAGGACAAAGGGAGGGAGCAAGCCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591585 | ||
| mod ID: M6ASITE061198 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188477-50188478:+ | [3] | |
| Sequence | CCTACTCGGATGGGGCACGGACTGTCCACCTTTTCTGATGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000413852.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591586 | ||
| mod ID: M6ASITE061199 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188525-50188526:+ | [3] | |
| Sequence | CAGCCTGTGCTGTGGCATAGACATGGATGCGAGGACCACTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000002829.8; ENST00000434342.5 | ||
| External Link | RMBase: m6A_site_591587 | ||
| mod ID: M6ASITE061200 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188539-50188540:+ | [3] | |
| Sequence | GCATAGACATGGATGCGAGGACCACTTTGGAGACTGGGGTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591588 | ||
| mod ID: M6ASITE061201 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188551-50188552:+ | [3] | |
| Sequence | ATGCGAGGACCACTTTGGAGACTGGGGTGGCCTCAAGAGCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000413852.5; ENST00000434342.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591589 | ||
| mod ID: M6ASITE061202 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188571-50188572:+ | [4] | |
| Sequence | ACTGGGGTGGCCTCAAGAGCACACAGAGAAGGGAAGAAGGG | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000413852.5; ENST00000434342.5 | ||
| External Link | RMBase: m6A_site_591590 | ||
| mod ID: M6ASITE061203 | Click to Show/Hide the Full List | ||
| mod site | chr3:50188711-50188712:+ | [3] | |
| Sequence | AGGCATCCTGCCTGGGTGGGACAGCCTCTTCAGCCCCTTCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; iSLK; TIME; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000002829.8; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591591 | ||
| mod ID: M6ASITE061204 | Click to Show/Hide the Full List | ||
| mod site | chr3:50189055-50189056:+ | [3] | |
| Sequence | GGGTTCCATCTTGCTAATAAACACTGGCTCTGGGACTAGAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000002829.8; ENST00000434342.5; ENST00000413852.5 | ||
| External Link | RMBase: m6A_site_591592 | ||
| mod ID: M6ASITE061205 | Click to Show/Hide the Full List | ||
| mod site | chr3:50189069-50189070:+ | [3] | |
| Sequence | TAATAAACACTGGCTCTGGGACTAGACTTTGGCTTCTCTCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000434342.5; ENST00000413852.5; ENST00000002829.8 | ||
| External Link | RMBase: m6A_site_591593 | ||
References
Back to top