Epigenetic Target Information

General Information of the Epigenetic Target (ID: EPITAR00100)
Target Name Transcription factor SOX-2 (SOX2)
Gene Name SOX2
Sequence
MYNMMETELKPPGPQQTSGGGGGNSTAAAAGGNQKNSPDRVKRPMNAFMVWSRGQRRKMAQENPKMHNSEISKRLGAEWKLLSETEKRPFIDEAKRLRALHMKEHPDYKYRPRRKTKTLMKKDKYTLPGGLLAPGGNSMASGVGVGAGLGAGVNQRMDSYAHMNGWSNGSYSMMQDQLGYPQHPGLNAHGAAQMQPMHRYDVSALQYNSMTSSQTYMNGSPTYSMSYSQQGTPGMALGSMGSVVKSEASSSPPVVTSSSHSRAPCQAGDLRDMISMYLPGAEVPEPAAPSRLHMSQHYQSGPVPGTAINGTLPLSHM
    Click to Show/Hide
Function
Transcription factor that forms a trimeric complex with OCT4 on DNA and controls the expression of a number of genes involved in embryonic development such as YES1, FGF4, UTF1 and ZFP206 (By similarity). Binds to the proximal enhancer region of NANOG (By similarity). Critical for early embryogenesis and for embryonic stem cell pluripotency. Downstream SRRT target that mediates the promotion of neural stem cell self-renewal (By similarity). Keeps neural cells undifferentiated by counteracting the activity of proneural proteins and suppresses neuronal differentiation (By similarity). May function as a switch in neuronal development (By similarity).
    Click to Show/Hide
Gene ID 6657
HGNC ID HGNC:11195
Ensembl Gene ID ENSG00000181449
KEGG ID hsa:6657
Chromosomal Location 3q26.33
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00100)
Transcription factor SOX-2 (SOX2)
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE063410 Click to Show/Hide the Full List
mod site chr3:181712559-181712560:+ [1]
Sequence CCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGC
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000325404.3; ENST00000646698.1; ENST00000628496.3; ENST00000498731.5; ENST00000595287.1; ENST00000593330.1; ENST00000642301.1; ENST00000491282.5; ENST00000595084.3; ENST00000492337.5; ENST00000466034.6; ENST00000627530.3; ENST00000596250.6; ENST00000629781.3; ENST00000646949.1; ENST00000629830.3; ENST00000629552.2; ENST00000600801.6; ENST00000626299.3; ENST00000498226.5; ENST00000597828.5; ENST00000645423.1; ENST00000600386.6; ENST00000593549.6; ENST00000628343.3; ENST00000646683.1; ENST00000642652.1; ENST00000477928.1; ENST00000485035.2; ENST00000626619.2; ENST00000469278.5; ENST00000493521.5; ENST00000476964.5; ENST00000630887.3; ENST00000628810.2; ENST00000600778.3; ENST00000645583.1; ENST00000646296.1; ENST00000646841.1; ENST00000598474.4; ENST00000627738.1; ENST00000599082.2; ENST00000597651.6; ENST00000627501.3; ENST00000629112.3; ENST00000642218.1; ENST00000630553.1; ENST00000643236.1
External Link RMBase: m6A_site_619714