Epigenetic Target Information

General Information of the Epigenetic Target (ID: EPITAR00089)
Target Name Cytochrome P450 2C8 (CYP2C8)
Synonyms
CYPIIC8; Cytochrome P450 IIC2; Cytochrome P450 MP-12; Cytochrome P450 MP-20; Cytochrome P450 form 1; S-mephenytoin 4-hydroxylase
    Click to Show/Hide
Gene Name CYP2C8
Sequence
MEPFVVLVLCLSFMLLFSLWRQSCRRRKLPPGPTPLPIIGNMLQIDVKDICKSFTNFSKVYGPVFTVYFGMNPIVVFHGYEAVKEALIDNGEEFSGRGNSPISQRITKGLGIISSNGKRWKEIRRFSLTTLRNFGMGKRSIEDRVQEEAHCLVEELRKTKASPCDPTFILGCAPCNVICSVVFQKRFDYKDQNFLTLMKRFNENFRILNSPWIQVCNNFPLLIDCFPGTHNKVLKNVALTRSYIREKVKEHQASLDVNNPRDFIDCFLIKMEQEKDNQKSEFNIENLVGTVADLFVAGTETTSTTLRYGLLLLLKHPEVTAKVQEEIDHVIGRHRSPCMQDRSHMPYTDAVVHEIQRYSDLVPTGVPHAVTTDTKFRNYLIPKGTTIMALLTSVLHDDKEFPNPNIFDPGHFLDKNGNFKKSDYFMPFSAGKRICAGEGLARMELFLFLTTILQNFNLKSVDDLKNLNTTAVTKGIVSLPPSYQICFIPV
    Click to Show/Hide
Family Cytochrome P450 family
Function
A cytochrome P450 monooxygenase involved in the metabolism of various endogenous substrates, including fatty acids, steroid hormones and vitamins . Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (NADPH--hemoprotein reductase). Primarily catalyzes the epoxidation of double bonds of polyunsaturated fatty acids (PUFA) with a preference for the last double bond. Catalyzes the hydroxylation of carbon-hydrogen bonds. Metabolizes all trans-retinoic acid toward its 4-hydroxylated form. Displays 16-alpha hydroxylase activity toward estrogen steroid hormones, 17beta-estradiol (E2) and estrone (E1). Plays a role in the oxidative metabolism of xenobiotics. It is the principal enzyme responsible for the metabolism of the anti-cancer drug paclitaxel (taxol).
    Click to Show/Hide
Gene ID 1558
HGNC ID HGNC:2622
Ensembl Gene ID ENSG00000138115
KEGG ID hsa:1558
Chromosomal Location 10q23.33
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00089)
Cytochrome P450 2C8 (CYP2C8)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004353 Click to Show/Hide the Full List
mod site chr10:95069474-95069475:- [1]
Sequence ATGTCAAAGAGACACACACTAAATTAGCAGGGAGTGTTATA
Transcript ID List ENST00000539050.5; ENST00000479946.2; ENST00000525991.5; ENST00000526814.5; ENST00000527953.5; ENST00000623108.3; ENST00000535898.5; ENST00000371270.6; ENST00000490994.6
External Link RMBase: RNA-editing_site_17628
mod ID: A2ISITE004354 Click to Show/Hide the Full List
mod site chr10:95069488-95069489:- [1]
Sequence ATTGTTTACTTTACATGTCAAAGAGACACACACTAAATTAG
Transcript ID List ENST00000535898.5; ENST00000539050.5; ENST00000490994.6; ENST00000623108.3; ENST00000479946.2; ENST00000371270.6; ENST00000525991.5
External Link RMBase: RNA-editing_site_17629
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE001455 Click to Show/Hide the Full List
mod site chr10:95036992-95036993:- [2]
Sequence AATATCCCATAAGCATCCAAACTCCATTAAGGAGAGTTGTT
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000539050.5; ENST00000527953.5; ENST00000525991.5; ENST00000371270.6; ENST00000535898.5; ENST00000623108.3; ENST00000526814.5; ENST00000533320.5; ENST00000490994.6; ENST00000527420.5
External Link RMBase: m6A_site_111657