Epigenetic Target Information
General Information of the Epigenetic Target (ID: EPITAR00081)
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00081)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE034511 | Click to Show/Hide the Full List | ||
| mod site | chr17:58331316-58331317:- | [1] | |
| Sequence | ACACGCCGACGGACAGACAGACAGTGCAGTCACCCATAAAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; BGC823; MT4; MM6; CD4T; peripheral-blood; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000579003.1; ENST00000384835.3 | ||
| External Link | RMBase: m6A_site_373733 | ||
References
Back to top