Epigenetic Target Information
General Information of the Epigenetic Target (ID: EPITAR00020)
RNA Modification Sequencing Data Associated with the Target (ID: EPITAR00020)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M1ASITE000101 | Click to Show/Hide the Full List | ||
| mod site | chr6:28742966-28742967:- | [1] | |
| Sequence | ATCAGAAGATTGAGGGTTCGAGTCCCTTCGTGGTCGTGTTC | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m1A-seq | ||
| Transcript ID List | rmsk_1902824; chr6.trna115 | ||
| External Link | RMBase: m1A_site_871 | ||
References
Back to top